-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Richard A. Fandino, et al.,
bioRxiv - Neuroscience 2019
Quote:
A 1.0 mm section of caterpillar horn from second-third instar larvae was harvested and placed in a 96-well plate with 10.0 µl of MyTaq™ Extract-PCR Kit Lysis buffer (2 µl Buffer A; 1 µl Buffer B; 7 µl ddH2O, Modified protocol from Bioline; Meridian Life Sciences; United States). Tissue was homogenized using a wet toothpick to quickly press the horn tissue to the side of the well or by cutting the horn multiple times in the lysis buffer ...
-
No products found
because this supplier's products are not listed.
Esther Cañibano, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 2 ug total RNA extracted from 7 day old seedlings with the Favorprep Plant Total RNA Purification Mini kit (Favorgen) was used for cDNAs synthesis with using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
3-Cyano-7-ethoxycoumarin is a small molecule which can act as a Cytochrom P450 Fluorescent...
Cat# abx282329-10MG,
10 mg USD $166.75
Ask
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-hTERT mAb (clone 10E9-2: MBL Co., Ltd., M216-3) and anti-hTERT sheep pAbs (Abbexa Ltd., abx120550) were used for immunoprecipitation (IP).
-
No products found
because this supplier's products are not listed.
Barbara J. Mann, et al.,
bioRxiv - Microbiology 2022
Quote:
... primed 7-day Alzet® osmotic pumps (Durect, Cuperton, CA) containing saline or drug were implanted subcutaneously (McCray et al. ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Andre Machado Xavier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using a 7 ml dounce tissue grinder (DWK Life Sciences, 357542) as performed in Gosselin et al ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Iliana Georgana, et al.,
bioRxiv - Microbiology 2023
Quote:
... Transfection was performed with PEI (CellnTec, 3 μL per 1 μg DNA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Caroline Passaes, et al.,
bioRxiv - Immunology 2019
Quote:
... Culture supernatants were assayed on day 7 using an SIV p27 Antigen ELISA Kit (Zeptometrix). Antiviral activity was calculated as log10 (mean p27 ng/mL in SIV-infected CD4+ T-cell cultures without CD8+ T-cells ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Shuo Yang, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-SARS-CoV-2-ORF3a (1:250; 101AP, FabGennix International Inc), anti-Actin (1:500 ...
-
No products found
because this supplier's products are not listed.
Vanessa Krauspe, et al.,
bioRxiv - Microbiology 2020
Quote:
... Gels were stained using either 20 mM zinc sulfate-7-hydrate for reversible zinc staining of chromophores and/or InstantBlue(tm) Coomassie staining (Expedeon). Otherwise ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Gong-Her Wu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Quantifoi®l R 2/2 Micromachined Holey Carbon grid: 200 mesh gold (SPI supplies Cat#:4420G-XA) grids were prepared for cell plating by sterilizing using forceps to carefully submerge them in 100% ethanol (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Sifang Liao, Dick R. Nässel,
bioRxiv - Neuroscience 2020
Quote:
... rabbit anti-tyrosine decarboxylase-2 (Tdc2; pab0822-P, Covalab, Cambridge ...
-
No products found
because this supplier's products are not listed.
Annelien Morlion, et al.,
bioRxiv - Genomics 2021
Quote:
... gDNA heat-and-run removal was performed by adding 1 μl HL-dsDNase (ArcticZymes #70800-202, 2 U/μl) and 0.68 μl reaction buffer (ArcticZymes #66001 ...
-
No products found
because this supplier's products are not listed.
Nauman Malik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5% bovine serum albumin and 0.05% sodium-Azide) containing either MOAB-2 (1:1000, Cat# M-1586-100, Biosensis) for the detection of Aβ or AT-8 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Angelino T. Tromp, et al.,
bioRxiv - Microbiology 2020
Quote:
CIC were determined by 2 different ELISA’s from Quidel (San Diego, CA): the CIC-C1q enzyme immunoassay is based on the principle that complement fixing IC will bind to immobilized human C1q purified protein ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 25-gauge butterfly needle attached to a peristaltic pump (#Minipuls 2; Rainin). Brains were removed and postfixed overnight at 4°C and then cut into 50 µm coronal sections using a vibratome (#TPI1000 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Chan Ho Park, et al.,
bioRxiv - Plant Biology 2022
Quote:
... anti-BSL2/3 (AbFrontier; 1:2,000 dilution), anti-FLAG (Sigma ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... difficile agar base (Oxoid) supplemented with 7% defibrinated horse blood (HemoStat Laboratories), 32 mg/L moxalactam (Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
Cat# H7A318-1,
USD $335.0/ml
Ask
Hanieh Ghassabian, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-IE1&2 mAb (Virusys Corporation, #CA003-1; 1:10,000), α-UL44 mAb (Virusys Corporation ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... HCA-7 cells were maintained in a 1:1 mix of DMEM and F12 (Thermo 11320033) supplemented with 10% FBS (Atlas Biologicals F-0500-D) and penicillin-streptomycin (Thermo 15140122) ...
-
No products found
because this supplier's products are not listed.
Daniel Lustberg, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and NET (mouse anti-NET; MAb Technologies, Neenah, WI, NET05-2; 1:1000). After washing in 0.01 M PBS ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Gayani Wijegunawardena, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2-chlorotrityl resin was purchased from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Ronan W. O’Connell, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Level 3 166k-member assemblies were purified using a miniprep column (Epoch Life Sciences), electroporated (BioRad ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Plates were washed again and incubated for 1h with K2 anti-dsRNA (SCICONS). After another wash ...
-
No products found
because this supplier's products are not listed.
Pallab Pradhan, et al.,
bioRxiv - Immunology 2020
Quote:
... Anti-CD3/CD28 bead (Dynabeads)-activated PBMCs (MSC/PBMC at 1:2) from healthy volunteers (purchased from Zen-Bio) plated in 200 ul culture media (RPMI 1640 + 10% FBS + 1% PS+ 30 IU/mL IL2 ...
-
No products found
because this supplier's products are not listed.
Niklas Schandry, et al.,
bioRxiv - Plant Biology 2021
Quote:
Individual isolates were pre-cultured in ½ strength TSB medium in 96-Well 2 ml deep-well plates (Semadeni) covered with a Breathe-Easy (Diversified Biotech) membrane until stationary phase for 6 d at 28°C and 180 rpm ...
-
No products found
because this supplier's products are not listed.
Robert V. Blair, et al.,
bioRxiv - Pathology 2020
Quote:
Serum samples collected at preinfection and at necropsy were tested for binding IgG antibodies against SARS-CoV-2 S1/S2 proteins using an ELISA kit from XpressBio (cat# SP864C). The assays were performed per directions of the manufacturer ...
-
No products found
because this supplier's products are not listed.
Laurent Jacob, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti–mouse LYVE-1 (11-034, AngioBio, 1:800), Goat anti– human PROX1 (AF2727 ...
-
No products found
because this supplier's products are not listed.
Hua He, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... or NKX2-1 antibody (Seven Hills Bioreagents, WRAB-1231, 1:1000) followed by incubation with TrueBlot HRP-Conjugated secondary antibody (Rockland Immunochemicals Inc ...