1 - 50 of 704
suppliers found for
7 1 3 dioxobutyl amino 3 hydroxynaphthalene 1 sulphonic acid
» view 10000+ matched products-
Alfa Chemistry Sponsored
Cat# ACM30128326, Inquire Ask
-
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... they were anaesthetized in 3-amino benzoic acid ethyl ester (Tricaine/ethyl 3-aminobenzoate; Sigma Aldrich; 168 μg·ml−1 in Tris pH 7) and embedded in 1% low melting point agarose (UltraPure Agarose ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: Caspase-1 and Caspase 3/7 activities were measured using Caspase-Glo® 1 and Caspase-Glo® 3/7 assay (Promega) respectively ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... 1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl] (DGS)–NTA and 1,2-dioleoyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.) were mixed at 1:3:96 molar % ratio ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Corning) and 1% penicillin-streptomycin (Gibco) ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... 1% nonessential amino acids (Lonza), 1 mM sodium pyruvate (Gibco ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ... -
Tocris
No products found because this supplier's products are not listed.Cited in On the Origin of Ultraslow Spontaneous Na+ Fluctuations in Neurons of the Neonatal ForebrainbioRxiv - Neuroscience 2020Quote: NNC-711 (1,2,5,6-Tetrahydro-1-[2-[[(diphenylmethylene)amino]oxy]ethyl]-3-pyridinecarboxylic acid hydrochloride) from Tocris -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... blocked in TBST with 3% BSA for 1 hour at room temperature and incubated in primary antibody solutions (in TBST with 3% BSA) directed against: phosphorylated (pY816, #4168, 1:1000; pY515, #9141, 1:1000; pY706-7, #4621S, 1:1000, Cell signaling technology (CST), Danvers ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: ... acid solubilized Type 1 collagen from rat tail tendon (3 mg/mL, BD Biosciences) was reconstituted in an ice bath to a final concentration of 2.5 mg/mL ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017Quote: ... 3 mM 3-mercaptopicolinic acid (3-MPA, Santa Cruz) was used to inhibit endogenous glucose production ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 1% non-essential amino acids (Merck) in a humidified incubator at 5% CO2 and 37 °C ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019Quote: ... 1% non-essential amino acids (VWR) and 1% L-glutamine (VWR) ... -
BioLegend
No products found because this supplier's products are not listed.Cited in Multiplexed biochemical imaging reveals caspase activation patterns underlying single cell fatebioRxiv - Cancer Biology 2018Quote: ... 7-AAD (7-amino-actinomycin D; Biolegend; 1:200), CaCl2 (2.5 mM ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... 6 mM amino acid mixture (average concentration of each amino acid 0.3 mM) and 0.1% (w/v) MNG-3 (Maltose Neopentyl Glycol-3, Anatrace). The feeding buffer contained 1x SUB-AMIX buffer (CellFree Sciences Japan) ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ... -
Proteintech
No products found because this supplier's products are not listed.Cited in Influenza A Virus Ribonucleoproteins Form Liquid Organelles at Endoplasmic Reticulum Exit SitesbioRxiv - Microbiology 2018, published in Nature Communications doi: 10.1038/s41467-019-09549-4Quote: ... atlastin 3 (1:100; Proteintech, 16921-1-AP) and NP (1:1000 ... -
GenScript
No products found because this supplier's products are not listed.Cited in The SAGA core module is critical during Drosophila oogenesis and is broadly recruited to promotersbioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... 15-octadecatrienoic acid (C18:3 ω-3, α-linolenic acid; Cayman Chemical, #90210), all cis-6 ... -
Alfa Aesar
No products found because this supplier's products are not listed.Cited in Auxin-Mediated Sterility Induction System for Longevity and Mating Studies in Caenorhabditis elegansbioRxiv - Genetics 2018, published in G3: Genes|Genomes|Genetics doi: 10.1534/g3.118.200278Quote: ... worms were transferred to NGM-agar plates containing 1 mM indole-3-acetic acid (Auxin, Alfa Aesar) following Zhang et al ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2022Quote: ... 1% HyClone non-essential amino acids (GE Healthcare Life Sciences), and 1% penicillin/streptomycin (P/S ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... neurotrophin-3 (NT-3, 1 ng/ml, PeproTech, Rocky Hill, NJ), and ciliary neurotrophic factor (CNTF,10 ng/ml ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2017, published in Nature Communications doi: 10.1038/s41467-018-03264-2Quote: ... Stainings were revealed with 3-amino-9-ethylcarbazole substrate (AEC, Dako) and nuclei counterstained with aqueous hematoxylin ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... 1 nM Fc and Sema4D-Fc (amino acids 24-711) (both R&D Systems), 100 nM Latrunculin B (Santa Cruz Biotechnology) ... -
Calbiochem
No products found because this supplier's products are not listed.Cited in Modulation of the combinatorial code of odorant receptor response patterns in odorant mixturesbioRxiv - Cell Biology 2020, published in Molecular and Cellular Neuroscience doi: 10.1016/j.mcn.2020.103469Quote: ... 1/500 7-amino-actinomycin D (7-AAD; Calbiochem), a fluorescent ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: Polybead Amino Microsphere 3 μm latex beads (Polysciences INC) were labeled with the fluorescent dye DyLight680 mono-N-hydroxysuccinimide (NHS ... -
Cambridge Isotope Labs
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: 3 μL of human plasma were spiked with 3 μL amino acid isotope labelled internal standards (Cambridge Isotope Laboratories, #MSK-A2-1.2) and extracted with 250 μL –20 °C methanol for 10 min and centrifuged at 4°C for 10 min at 15 000 g ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... AEC (3-Amino-9-EthylCarbazole; Vector Laboratories, Burlingame, CA) was used as chromogen ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... TSA® Plus Cyanine 3 (PerkinElmer, 1:1,500) was used as a secondary fluorophore for Hbs1l-C2 probes. -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... 1% Non-essential amino acids (BioInd.) and 0.1mg/ml Primocin (InvivoGen). -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-[3-(dimethylamino)propyl]-carbodiimide (EDC) was purchased from TCI EUROPE (Eschborn ... -
Novus Biologicals
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Cell Reports doi: 10.1016/j.celrep.2019.02.027Quote: ... anti-mGlur2/3 (Novus Biologicals, NB300-124, 1:1000), anti-actin (Abcam ... -
Bioworld Technology
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... Plates were then washed 5 times with PBS/0.05% Tween20 prior to development with 100μL of 0.1% 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS, Bioworld, Dublin, OH, USA) solution with 0.05% H2O2 for 18 minutes at 37°C ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... that also was supplemented with 1 mM 3-amino-1,2,4-triazole (MP Biomedicals, Irvine CA, 4061-722). -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ... -
Stemcell Technologies
No products found because this supplier's products are not listed.Cited in Expansion and differentiation of ex vivo cultured erythroblasts in scalable stirred bioreactorsbioRxiv - Bioengineering 2022Quote: ... and interleukin-3 (IL-3; 1 ng/mL, first day only; Stemcell Technologies; Canada). Cell density was maintained between 0.7-2×106 cells/mL by daily feeding with fresh expansion medium. -
Jena Bioscience
No products found because this supplier's products are not listed.Cited in Herpes simplex virus 1 protein pUL21 stimulates cellular ceramide transport by activating CERTbioRxiv - Microbiology 2022Quote: ... and 1 μL of 3-azido-7-hydroxycoumarin solution (1 mM in EtOH; Jena Bioscience) was added ... -
Mbl International
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in Development doi: 10.1242/dev.179432Quote: ... ATPase (MBL International Corp. D032-3, 1:200), P63 (Santa Cruz sc-8343 ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... After that, Samples were infiltrated in graded mixtures (1:3, 1:1, 3:1) of resin (EMS, Resin Mixture ... -
Biotium Inc.
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: Cell death within tumor slices was assessed using a green-fluorescent caspase 3/7 probe that binds DNA upon cleavage by caspase 3/7 (Nucview, Biotium). 2.106 untransduced or EGFR CAR T cells were applied onto BxPC3 tumor slices that were subsequently incubated with 5μM of NucView dye ... -
Axon Medchem
![Cuspin-1 - CAS [337932-29-3], 99%](https://image.labshake.com/supplier-product/305cc4ba-a97e-4815-88b6-a95430b03ef4/d8af4a78-42ca-4287-b1a6-f1c8780aa577.png)
SMN upregulator Sold for research purposes only.Cat# 2438.0, SKU# 2438-10 mg, 10mg, US $104.50 / EA, EURO, €95 / EA AskbioRxiv - Cell Biology 2022Quote: ... 1 µM MEK inhibitor PD and 3 µM GSK-3 inhibitor CHIR (2i, Axon Medchem). To assess the SILAC labeling efficiency ... -
World Precision Instruments
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Neuron doi: 10.1016/j.neuron.2020.04.026Quote: ... A 3 mm glass coverslip (#1 thickness, World Precision Instruments) was glued onto the tube to seal the end that was inserted into the craniotomy ... -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ... -
Bachem
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2021Quote: ... 3-Amino-L-tyrosine (Bachem), 4-Amino-L-phenylalanine (Bachem) ... -
Synaptic Systems
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... α3 (1:250, extracellular epitope; Synaptic Systems #224 303), α5 (1:250 ...