-
No products found
because this supplier's products are not listed.
Nicolas J. Guehl, et al.,
bioRxiv - Neuroscience 2020
Quote:
4-amino-3-hydroxypyridine and 4-amino-3-methoxypyridine were purchased from Astatech (cat# 22383 and 35474). Anhydrous solvents were purchased from Acros Organics ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Michael Berger, Naubahar S. Agha, Alexander Gail,
bioRxiv - Neuroscience 2020
Quote:
... we oriented and lowered the microelectrode arrays one-by-one using a manual micro-drive (Narishige International Limited, London, UK), which was mounted to the stereotaxic instrument on a ball-and-socket joint ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Mirjana Grujic, et al.,
bioRxiv - Immunology 2022
Quote:
... and 3 µl Draq7 (Biostatus, Shepshed Leicestershire ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433; Boron Molecular, >95%) were used as received ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Maja Gehre, et al.,
bioRxiv - Genetics 2019
Quote:
... Lysis buffer was prepared by diluting one part direct-lysis reagent (301-C, Viagen Biotech) in two parts destilled water (e.g ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... All cell lines were tested for mycoplasma using the VenorGem One Step PCR Kit (Cambio) and STR-profiled using the Cell authentication service by Eurofins Medigenomix.
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Eman A. Akam, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tert-Butyl 3-aminopropoxycarbamate was purchased from AmBeed and used without further purification ...
-
No products found
because this supplier's products are not listed.
Liangxi Wang, et al.,
bioRxiv - Genomics 2022
Quote:
... One biological replicate of primary mouse aortic endothelial cells (Cell Biologics, cat# C57-6052, lot# B092913T2MP) was selected and cultured following the methods of Alizada et al ...
-
No products found
because this supplier's products are not listed.
Clémence Bernard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and (4) literature on interneuron connectivity (MEDLINE search for “gene name” and “synapse” and “interneuron”) ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Marina Barba-Aliaga, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and mixed with one volume of glass beads for further homogenization in a Precellys tissue homogenizer (Bertin Corp.). Lysates were cleared by centrifugation at 12000 rpm for 5 min at 4°C and protein extracts were assayed for firefly and Renilla luciferase activity sequentially in a 96-well luminometry plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Qinghong Xue, et al.,
bioRxiv - Immunology 2019
Quote:
... and goat IgG (i.e., three positive control points) were printed in 4×4 array by non-contact spotter sciFLEXARRAYER S1 (Scienion, Berlin, Germany) (Fig 2d) ...
-
No products found
because this supplier's products are not listed.
Changwen Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... one library containing FDA approved drugs that can penetrate through blood-brain barrier (269 drugs from TargetMol, Massachusetts, USA), and one library containing drugs targeting the possible targets identified in omics analysis (58 drugs from MedchemExpress ...
-
No products found
because this supplier's products are not listed.
Satish K. Tadi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples were then loaded into custom-made C18 StageTips packed by stacking one AttractSPE® disk (#SPE-Disks-Bio-C18-100.47.20 Affinisep) and 2mg beads (#186004521 SepPak C18 Cartridge Waters ...
-
No products found
because this supplier's products are not listed.
Christina Hipfinger, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Samples were prepared by loading the middle cages of 4×4 LEGO scaffolds with VEGF supplemented GelMA microgels and the supplementary peripheral cages with BMP2 (Shenandoah Biotechnology, Inc.) supplemented with GelMA microgels ...
-
No products found
because this supplier's products are not listed.
Liang Qu, et al.,
bioRxiv - Immunology 2022
Quote:
... and NHP IL-4 ELISpot assay kit (U-CyTech). The cryopreserved rhesus macaques PBMCs were thawed and cultured with pre-warmed AIM-V media ...
-
No products found
because this supplier's products are not listed.
Emily L. Pruitt, et al.,
bioRxiv - Microbiology 2023
Quote:
... and C20:4 (Nu-Chek Prep, Inc., Elysian, MN) in ethanol each at 100 μM in TSB ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Ugrappa Nagalakshmi, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Sterilized seeds were placed on one-half strength MS medium containing Gamborg vitamins (Phyto Technologies Laboratories) solidified with 0.25% Phytoblend (Caisson Labs) in petri plates (100 mm × 25 mm) ...
-
No products found
because this supplier's products are not listed.
Mary Kefi, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... After validation of recombinant protein expression of expected size in Sf9 cells and determination of viral stock titers using baculoQUANT ALL-IN-ONE (GenWay), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Victoriane Peugnet, et al.,
bioRxiv - Cell Biology 2021
Quote:
... from which a low voltage alternating current (20 mV) is generated in the culture medium from one electrode to another by an iCELLingence system (00380601000, ACEA Biosciences). The electrical resistance of adherent cells (RCell ...
-
No products found
because this supplier's products are not listed.
Sang Hyuk Lee, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... A magnetic stir rod was added to one of the two flasks along with 100g of Alconox® powder (Alconox, NY). This flask was placed on a Nuova Stir Plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Jixing Li, Marco Lai, Liina Pylkkänen,
bioRxiv - Neuroscience 2023
Quote:
... This task differed from the prior minimal composition studies which have only used one matching or mismatching task picture (Bemis & Pylkkanen, 2011). The reason for our larger set of pictures was that this decreased the chance of an accurate response by chance ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Momei Zhou, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were fixed with 4% PFA at 4 days post-infection and processed with Immunohistochemistry (IHC) using mouse monoclonal anti-VZV antibody (Meridian Life Sciences C05108MA, 1:2000 diluted in PBS), followed by incubation with biotinylated anti-mouse IgG (Vector Laboratories #BA-9200) ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the resin and the peptide was precipitated out using diethyl ether at -80°C ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
Christina M. Kelliher, et al.,
bioRxiv - Genomics 2020
Quote:
... PCR genotyping was performed on gDNA extracts from conidia incubated with Allele-In-One Mouse Tail Direct Lysis Buffer (Allele Biotechnology # ABP-PP-MT01500) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Toshiomi Katsuki, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 30 µg/body 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate labelled HDL (Dil-HDL: KALEN Biomedical, MD, USA) was used ...
-
No products found
because this supplier's products are not listed.
Jun Li, et al.,
bioRxiv - Bioengineering 2023
Quote:
YS5 was first conjugated with the bi-functional chelator 2-(4-isothiocyanotobenzyl)-1,4,7,10-tetraaza-1,4,7,10-tetra-(2-carbamoylmethyl)-cyclododecane (TCMC; Macrocyclics, Plano, TX) at the molar ratio of TCMC/YS5 at 10:1 ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Dani Flinkman, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and filtered through Whatman Grade 3 filter material and cleaned-up with C18-UltraMicroSpin columns (The Nest Group, Inc., Southborough, USA). The peptides were then dried and dissolved in 0.1 % Formic acid (FA) ...
-
No products found
because this supplier's products are not listed.
Matthieu Fritz, et al.,
bioRxiv - Microbiology 2023
Quote:
... and amplicons approximately 2–3 kb in size were excised from the gel and purified using the Quick-spin PCR Product Purification Kit (iNtRON Biotechnology, Korea). The amplicons were further cloned in pJET1.2 cloning plasmid (ThermoFisher Scientific ...