1 - 50 of 726
suppliers found for
7' BROMO 2' 3' DIHYDRO 1'H SPIRO CYCLOPROPANE 1 4' ISOQUINOLINE
» view 10000+ matched products-
Alfa Chemistry Sponsored
Cat# ACM885269318, Inquire Ask
-
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019Quote: ... and 1-bromo-3-chloropropane (Sigma), and 1 μg was reverse transcribed into cDNA using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher) ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ... -
Tocris
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... or washed three times in water and stained with 10 μM (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T)(Tocris) in 50 mM KCl ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... T cells were cultured with 2-deoxy-2-((7-nitro-2, 1, 3-benzooxadiazol-4-yl)amino)-glucose (2-NBDG) (Abcam 50μM, 1h), 4 ... -
Promega
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... Apoptosis was assessed by incubating the cells with 200nM Staurosporin or medium for 4 h and the caspase 3/7 activity was assayed using the ApoOne Caspase 3/7 Assay (Promega). Senescence associated β-Galactosidase activity was analyzed with the Senescence Associated β-Galactosidase Staining Kit (Cell Signalling Technologies) ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2017, published in Developmental Cell doi: 10.1016/j.devcel.2017.10.011Quote: ... and GAB1 (Santa Cruz Biotechnology clone H-7, diluted 1:400) were used with appropriate secondary reagents ... -
Avanti Polar Lipids
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2020Quote: ... or (iv) POPG and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) at 7:3 ratio (all lipids from Avanti Polar Lipids). The protein-liposome mixtures ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in eLife doi: 10.7554/eLife.50523Quote: ... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ... -
Gold Biotechnology
No products found because this supplier's products are not listed.Cited in An interaction map of transcription factors controlling gynoecium development in ArabidopsisbioRxiv - Plant Biology 2018Quote: ... the gynoecia were collected and incubated 7 h at 37°C with a 5-bromo-4-chloro-3-indolyl-b-glucuronic acid solution (Gold Biotechnology, St Louis ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE. -
Merck
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019Quote: ... and mixed with 1 volume of 1-bromo-3-chloropropane (Merck). Samples were spun (2min ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: anti-Dynamin 1/2/3-mouse (BD Science, 1:1000), anti-Pacsin2-Rabbit (Proteintech ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... 4’,6-diamidino-2-phenylindole (1:10,000; Biolegend) was used. -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... at RT for 1 h followed by staining with DAPI (Vector Laboratories, H-1800-2). Images were acquired with Leica DMi8 microscope. -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020, published in Advanced Science doi: 10.1002/advs.202001467Quote: ... 4°C for 1 h with MLS-55 rotor (Beckman Coulter). The pellets were lysed in 40 μL of radioimmunoprecipitation (RIPA ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in Molecular Pharmacology doi: 10.1124/mol.119.117069Quote: ... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ... -
GE Life Sciences
No products found because this supplier's products are not listed.Cited in Inhibition of selective autophagy by members of the herpesvirus ubiquitin-deconjugase familybioRxiv - Cell Biology 2021Quote: ... For co-immunoprecipitation of endogenous SQSTM1/p62 the cell lysates were incubated for 2-4 h with specific antibody followed by 1-2 h with protein-G coupled Sepharose beads (GE Healthcare, 17-0885-01). To resolve protein complexes for denaturing immunoprecipitation ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... samples were further statically incubated for 1 h at 4°C with APC-conjugated polyclonal goat-anti-human IgG F(ab’)2 antibody (Jackson immunoresearch, 1:500). Fab fragments were detected with Alexa Fluor 647 conjugated goat-anti-human-kappa F(ab’)2 antibody (Southern Biotech ... -
Polysciences
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ... -
Electron Microscopy Sciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... fixed for 1 h in 4% PFA (Electron Microscopy Sciences, Cat# 15714)/Hydra medium ... -
Proteintech
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2021Quote: ... the membranes were incubated at room temperature for 4 h with anti-Reelin (20689-1-AP, Proteintech, 1:1000), anti-ADAMTS4 (SRP00350 ... -
Addgene
No products found because this supplier's products are not listed.Cited in USP22 controls type III interferon signaling and SARS-CoV-2 infection through activation of STINGbioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ... -
Agilent
No products found because this supplier's products are not listed.Cited in Reconstructing cell interactions and state trajectories in pancreatic cancer stromal tumoroidsbioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2020Quote: ... For all assays 1 μCi [3 H]-D-glucose (PerkinElmer, USA) was used as the radioactive tracer ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... 0.5 mM RA and 1 mM 8-bromo-cAMP (Peprotech, 2354843) were added ... -
Qiagen
No products found because this supplier's products are not listed.Cited in CRISPR screen reveals that EHEC’s T3SS and Shiga toxin rely on shared host factors for infectionbioRxiv - Microbiology 2018, published in mBio doi: 10.1128/mBio.01003-18Quote: ... and after each round of infection with EHEC ΔespZ (rounds 1, 2, 3 and 4) using the Blood and Cell Culture DNA Maxi Kit from Qiagen. The gDNA was subjected to PCR to amplify guide RNA sequences as previously described (26) ... -
Alfa Aesar
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020Quote: ... 7-Bromo-1-heptanol (H54762, Alfa Aesar), EZview™ Red anti-FLAG® M2 affinity gel (F2426 ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: RNA was extracted using a modified phenol-chloroform protocol (Chomczynski and Sacchi, 2006) with 1-Bromo-3-chloropropane and Isopropanol (Sigma and VWR, respectively). Total RNA was quantified and assessed for quality and integrity by Bioanalyser (RNA Pico 6000 Chip ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2022Quote: ... The fluorescent glucose analog 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino)-2-deoxyglucose (2-NBDG) was purchased from Cayman Chemical Company ... -
anatrace
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019, published in Journal of Biological Chemistry doi: 10.1074/jbc.RA119.008837Quote: ... pH 7.6] for 2 h at RT and incubated overnight (ON) at 4°C with antibodies against TRKB (1:1000, #AF1494, R&D Systems); AP2M (1:1000 ... -
Tokyo Chemical Industry
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... and 1-bromo-3-chloropropane (TCI America, Product # B0575), precipitated with isopropanol and treated with DNase I (Invitrogen ... -
Synaptic Systems
No products found because this supplier's products are not listed.Cited in Diffusion MRI Anisotropy in the Cerebral Cortex is Determined by Unmyelinated Tissue FeaturesbioRxiv - Neuroscience 2022Quote: ... Then the section was incubated for 60 h at 4°C with a 1:200 dilution of a rabbit anti MAP-2 primary antibody (188 003, Synaptic Systems, Germany) and for 3 h with a 1:250 dilution of a goat anti-rabbit secondary antibody conjugated to DyLight 680 fluorophore (35569 ... -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ... -
Jena Bioscience
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in BMC Biology doi: 10.1186/s12915-019-0708-7Quote: ... incubated with SiR-Tet (1–2 µM, 1 h; Spirochrome, Stein am Rhein, Switzerland) or TAMRA-Tet (2 µM, 1 h; Jena BioScience, Germany) and washed again with fresh medium (3 × quick wash and 3 × 30 min wash ... -
Leica
No products found because this supplier's products are not listed.Cited in PAT2 regulates autophagy through vATPase assembly and lysosomal acidification in brown adipocytesbioRxiv - Cell Biology 2020Quote: ... Tissues were fixed with 4% PFA for 1 h prior to vibratome (Leica) sectioning at 100 μm ... -
SouthernBiotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0226396Quote: ... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech). -
Eppendorf
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ... -
Novus Biologicals
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in eLife doi: 10.7554/eLife.53994Quote: ... Simultaneous incubation (48 h at 4 °C) with rat anti-FLAG (1:100; Novus Biologicals NBP1-06712,A-4) and rabbit anti-AANAT1 was followed by another 48 h at 4 °C with goat anti-rabbit (1:1000 ... -
Biotium Inc.
No products found because this supplier's products are not listed.Cited in A unique adhesive motif of protein disulfide isomerase P5 supports its function via dimerizationbioRxiv - Biochemistry 2020Quote: ... Cells were incubated at 4°C for 4 h with CF488-conjugated anti-mouse IgG (1:2000) and CF568-conjugated anti-rabbit IgG (1:2000) antibodies (Biotium) diluted in PBS containing 2% FBS as secondary antibodies ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: ... hiPSC colonies were passaged 1:6 every 4 to 7 days with Gentle Cell Dissociation Reagent (STEMCELL Technologies). Genomic integrity was validated by G-band karyotyping (Cell Line Genetics ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Male and female (Figures 2-3) or male (Figures 4-7) eight-week-old B6.Cg-Tg(K18-hACE2)2Prlmn/J mice (Jackson Laboratory 034860) were anesthetized with a single intraperitoneal dose of ketamine (Patterson Veterinary 07-803-6637 ... -
LI-COR
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... at 4°C overnight and 1 h with appropriate secondary antibodies (LI-COR Biosciences). Image acquisition was performed with an Odyssey infrared imaging system (LI-COR Biosciences ... -
Invivogen
No products found because this supplier's products are not listed.bioRxiv - Immunology 2022Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant for immunizations 1 and 2 and O/W for immunization 3 (Invivogen, San Diego, CA) to reach a final concentration of 0.250 mg/mL antigen ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... 10 μg of RNA were fractionated on a 2% NuSieve 3:1 agarose (Lonza), 1X MOPS ... -
ChromoTek
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... protein extracts were incubated for 1-2 h at 4°C with GFP-Trap_MA (magnetic beads, ChromoTek, handling according to manufacturer’s manual) ...