-
No products found
because this supplier's products are not listed.
Audrey Frances, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... ethyl ester (TMRE, Sigma) or 100nM MitoTracker Green (MTG ...
-
No products found
because this supplier's products are not listed.
Oleg S. Matusovsky, et al.,
bioRxiv - Biophysics 2022
Quote:
... NPE-caged ATP (adenosine 5’-triphosphate, P3- (1-(2-nitrophenyl ethyl) ester) (Invitrogen) dissolved in attachment buffer was photolyzed in the AFM chamber using an UV light source at 340 nm ...
-
No products found
because this supplier's products are not listed.
Jason S Hong, et al.,
bioRxiv - Immunology 2021
Quote:
... ethyl ester (TMRE) (Abcam), and Mitotracker Greeen (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 7-(Hydroxyimino)cyclopropa[b]chromen-1a-carboxylate ethyl ester (CPCCOEt, Tocris®); Tetrodotoxin (TTX ...
-
No products found
because this supplier's products are not listed.
Mesfin Meshesha, et al.,
bioRxiv - Bioengineering 2023
Quote:
Pyrrole (C4H5N) 98.0% (Merck, Germany) was vacuum distilled before use ...
-
No products found
because this supplier's products are not listed.
Jung-Min Kim, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and TMRE (tetramethylrhodamine ethyl ester, Biotium, 70005), respectively ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Gergana Shipkovenska, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... treated with 3% ethyl methanesulfonate (EMS)(Winston ...
-
No products found
because this supplier's products are not listed.
Lisa Weixler, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... anti-tubulin 1:5000 (B-5-1-2 Santa Cruz). For slot blotting ...
-
No products found
because this supplier's products are not listed.
Connor S. Murphy, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and resuspended in tetramethylrhodamine ethyl ester (TMRE) buffer (Cayman Chemicals) containing 100 nM TMRE (Cayman Chemicals ...
-
No products found
because this supplier's products are not listed.
Masaki Tsuchiya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... [2-[(Methylthio)(2H-pyrrol-2-ylidene)methyl]-1H-pyrrole](difluoroborane) (TCI, M2609) was reacted with dibenzocyclooctyne-amine (TCI ...
-
No products found
because this supplier's products are not listed.
Kehui Xiang, David P. Bartel,
bioRxiv - Molecular Biology 2021
Quote:
... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
No products found
because this supplier's products are not listed.
Valentine Mosbach, et al.,
bioRxiv - Genetics 2019
Quote:
... digested for 6h by SspI (20 U) (NEB), loaded on a 1% agarose gel (15×20 cm ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
Cat# HY-17378-5 mg,
5 mg, USD $60.0
Ask
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Valsartan ethyl ester was obtained from MedChemExpress. 3-hydroxy-3-methylglutaric acid (HMG ...
-
No products found
because this supplier's products are not listed.
Hossein Mohammad-Beigi, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... available as water-soluble Sulpho-Cyanine 5 or Sulpho-Cyanine 3 NHS esters (Lumiprobe), or pHrodo Red NHS esters (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Rodrigo Guabiraba, et al.,
bioRxiv - Immunology 2023
Quote:
... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
No products found
because this supplier's products are not listed.
Mohamad Javad Norahan, et al.,
bioRxiv - Biophysics 2021
Quote:
The P3-[1-(2-nitrophenyl)ethyl] ester (NPE) of GTP was obtained from Jena Bioscience (Jena, Germany). P3-[para-hydroxyphenacyl] ester (pHP ...
-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Cells were grown to 70% confluent in 24-well plates prior to treatment with N-[2-[[3-(4-Bromophenyl)-2-propenyl]amino]ethyl]-5-isoquinolinesulfonamide dihydrochloride (H89; R&D Systems) or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437 ...
-
No products found
because this supplier's products are not listed.
Qinqin Fei, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1,2-dipalmitoyl-sn-glycero-3-phospho((ethyl-1’,2’,3’-triazole)triethyleneglycolmannose) (ammonium salt) (PA-PEG3-mannose) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). Linoleic acid (LA) ...
-
No products found
because this supplier's products are not listed.
Yuko Sato, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 3’-primary amino-modified miR-430 MO (5’-TCTACCCCAACTTGATAGCACTTTC-3’) was obtained from Gene tools LLC and labeled with Cy3 NHS-ester (GE Healthcare). After the conjugation for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Ashley N. Anderson, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... followed by 3 x 5 minute washes in 2 × SSC (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Aishwarya Rengarajan, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Collagenase B solution 2 mg ml−1 B (Roche, Indiana) was used for HUVEC isolation (detailed protocol in 10) ...
-
No products found
because this supplier's products are not listed.
Mehdi Benlarbi, et al.,
bioRxiv - Microbiology 2024
Quote:
... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
No products found
because this supplier's products are not listed.
Jianjian Zhao, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... EA (ethyl acetate, 2×10-3 in dilution, Alfa Aesar) and IA (isoamyl acetate ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Sapir Herchcovici Levi, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (PeproTech, SM-2520691-B) and 0.2 µM PD0325901 (PeproTech ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Soledad Marsile-Medun, et al.,
bioRxiv - Immunology 2024
Quote:
... PE-CD32a/b (FUN-2, Biolegend #303206), PE-CD64 (10.1 ...
-
No products found
because this supplier's products are not listed.
Dipsikha Biswas, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 500 µl of ethyl acetate (ethyl acetate; VWR) following which they were centrifuged at 500g at RT for 15 min ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Bradley M. Readnour, et al.,
bioRxiv - Microbiology 2021
Quote:
... succinimidyl ester)-LPSXG-(5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid) (Edans) peptides were provided by GenScript (Piscataway, NJ). Six peptide sequences were selected for study ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Alessandra Pisciottani, et al.,
bioRxiv - Neuroscience 2023
Quote:
Cortical neurons were incubated with 4 μM fura-2 acetoxymethyl ester (AM, Calbiochem, CAS 108964-32-5) 40 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Doyoung Kwon, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... 3-[2-(N,N-diethyl-N-methylammonium)ethyl]-7-methoxy-4-methylcoumarin (AMMC, 100 μM; Cyp2d10; Cat. No. 451700, Corning Inc.), 7-methoxy-4-(trifluoromethyl)-coumarin (MFC ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Martin H. Berryer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 5 mL N2 supplement B (StemCell Technologies, 07156)] supplemented with SB431542 (10 µM ...
-
No products found
because this supplier's products are not listed.
Huan Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-B cell lymphoma-2 (Bcl-2) (Cell Signaling Technology, USA, #3498S) and anti-CCAAT enhancer binding protein-α (CEBP-α ...
-
No products found
because this supplier's products are not listed.
Aakash Chandramouli, Siddhesh S. Kamat,
bioRxiv - Biochemistry 2024
Quote:
... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
No products found
because this supplier's products are not listed.
Amelia R. Townley, Sally P. Wheatley,
bioRxiv - Cancer Biology 2020
Quote:
... 100 nM MitoTracker Green FM and 100 nM MitoTracker Deep Red FM or 200 μM tetramethylrhodamine ethyl ester perchlorate (TMRE, AAT Bioquest). Immediately before imaging ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Abishek Chandrashekar, et al.,
bioRxiv - Microbiology 2022
Quote:
... SARS-CoV-2 (B.1.1.529) RBD proteins (Sino Biological) labeled with APC and DyLight 405 ...
-
No products found
because this supplier's products are not listed.
Lior Artzi, et al.,
bioRxiv - Microbiology 2021
Quote:
... in 2 mL tubes containing lysis matrix B (MP Biomedicals). Immediately after lysis ...
-
No products found
because this supplier's products are not listed.
Yu-Chia Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality.
-
No products found
because this supplier's products are not listed.
Manu De Groeve, Bram Laukens, Peter Schotte,
bioRxiv - Microbiology 2023
Quote:
... 2 L or 5 L scale (Biostat B-plus and B-DCU units, Sartorius Stedium Biotech) as previously described [PMID ...
-
No products found
because this supplier's products are not listed.
Rachel Wong, Deepta Bhattacharya,
bioRxiv - Immunology 2020
Quote:
... with 4-hydroxy-3- nitrophenylacetyl-O-succinimide ester (Biosearch Technologies).
-
No products found
because this supplier's products are not listed.
Lucia Cassella, Anne Ephrussi,
bioRxiv - Cell Biology 2021
Quote:
... (2017) to generate oligonucleotides labelled at their 3’ and with ATTO-633-NHS ester (ATTO-TEC). When dual-color smFISH experiments were performed ...
-
No products found
because this supplier's products are not listed.
Ed Zandro M. Taroc, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Cell counts were done on serial sections immunostained for GnRH-1 at E13.5 (n=3) and E15.0 (n=4) and visualized under bright field (immunoperoxidase) or epi-fluorescence illumination (20×; Leica DM4000 B LED), according to their anatomical location [i.e. ...
-
Chromatographically purified. A solution in 100 mM sodium chloride. Chymotrypsin and trypsin ² 0.02%.
Cat# LS005302,
Bulk, Inquire
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...