-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
Cat# 22052-03-5,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rats received one intraperitoneal injection of 5-Ethynyl-2’-deoxyuridine (EdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 61135-33-9) and were killed 6 (CTL n = 8 ...
-
No products found
because this supplier's products are not listed.
Pramod Sahadevan, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Collagen-coated hydrogel-bound (8 kPa) polystyrene 35mm (PS35-COL-8) and 6-well (SW6-COL-8) plates were from Matrigen. Phos-tag acrylamide was from Wako Chemicals (#AAL-107) ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Bao Gia Vu, et al.,
bioRxiv - Genetics 2021
Quote:
... 2% glucose] or under amino acid-selective conditions in complete supplemental medium (CSM) (Difco yeast nitrogen extract without amino acids, amino acid powder from Sunrise Science Products, 2% glucose). All solid media contained 1.5% agar ...
-
No products found
because this supplier's products are not listed.
Andry Andrianarivelo, et al.,
bioRxiv - Neuroscience 2021
Quote:
9-tert-butyl doxycycline hydrochloride (9-TB-dox; Tebu-bio, Le Perray-en-Yvelines, France) was dissolved in a saline solution containing DMSO (5% ...
-
No products found
because this supplier's products are not listed.
Patrícia Dias Carvalho, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... After one wash in 1% bovine serum albumin (BSA; NZYtech) in PBS 1x ...
-
No products found
because this supplier's products are not listed.
Lindsey Van Haute, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Bisulfite conversion of 2 µg DNase treated RNA was performed using the Methylamp One-Step DNA modification kit (Epigentek). The reaction mixture was incubated for three cycles of 90°C for 5 min and 60°C for 1h ...
-
No products found
because this supplier's products are not listed.
A Hendriks, et al.,
bioRxiv - Microbiology 2020
Quote:
... for IL-8 (Sanquin) and TNFα (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Mansi Prakash, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and tissue was triturated for about 1 min (90% tissue dispersal) using a 9” sterile silanized glass Pasteur pipette (BrainBits), avoiding air bubbles ...
-
No products found
because this supplier's products are not listed.
Eric Largy, Valérie Gabelica,
bioRxiv - Biophysics 2020
Quote:
... an MX Series II 2 Position/6 Port UltraLife Switching Valve (IDEX Health & Science, Oak Harbor, WA, USA) was used (see Figure S3) ...
-
No products found
because this supplier's products are not listed.
Nicole B. Webster, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Total RNA was extracted from mixed stage 1–9 embryos and larvae using the RNA Trizol extraction protocol (Molecular Research Center, Inc.) or the RNeasy Mini Kit (Qiagen cat ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 8 ng/mL Cholera Toxin (CELL technologies), 5 ng/mL insulin (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and chicken anti-microtubule associated protein 2 (MAP2, 1:500, EnCor Biotechnology Inc, FL, USA), followed by an incubation (3 days ...
-
No products found
because this supplier's products are not listed.
Timothy A. Troppoli, et al.,
bioRxiv - Neuroscience 2023
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#87900, Point Style 2, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Nicholas H Harbin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... sections were rinsed in TBS-gelatin and incubated for 2 hours with secondary goat anti-rabbit Fab fragments conjugated to 1.4-nm gold particles (1:100; Nanoprobes, Yaphank, NY) and 1% dry milk in TBS-gelatin to limit cross-reactivity of the secondary antibody ...
-
No products found
because this supplier's products are not listed.
Anna Kirjavainen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 2% Choleratoxin B subunit (#104; List Biological Lab.Inc.) were injected at the speed of 50 nl/min using a microinjector (UltraMicroPump III ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and mCherry (ThermoFisher #PA534974 at 1:1000; Invitrogen #M11217 at 1:500; PhosphoSolutions #1203-mCherry at 1:10,000). Multiple PDE11A antibodies were utilized to discern the ectopic accumulation of PDE11A4 in ghost axons ...
-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... 1-1.5 mg of protein lysate was incubated with Id2 (9-2-8, CalBioeagents) or Id3 (6-1, CalBioreagents) antibody overnight at 4°C followed by protein A/G agarose beads (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Snježana Kodba, et al.,
bioRxiv - Cell Biology 2024
Quote:
... one well of an 8-well Ibidi chambers (IBI Scientific #80807) was coated with 10 mg/mL Laminin (Sigma ...
-
No products found
because this supplier's products are not listed.
Hamid Keshmiri, et al.,
bioRxiv - Biophysics 2023
Quote:
... U2OS cells were treated with 10 µM trichostatin A (TSA) for 6h (AbMole M1753), 25 µM camptothecin for 1h (Sigma-Aldrich C9911) ...
-
No products found
because this supplier's products are not listed.
Uxia Gurriaran-Rodriguez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... After 6h of transfection cells were treated overnight with PORCN inhbibitor diluted in DMSO (AdooQ) at two different concentrations 100nM and 500nM in fresh media ...
-
No products found
because this supplier's products are not listed.
Maria Kristina Parr, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PC) and ecdysone (2β,3β,14α,22R,25-pentahydroxy-5β-cholest-7-en-6-one, 1) were purchased from Steraloids (Newport, USA), while ponasterone (2β,3β,14α,20β,22R-pentahydroxy-5β-cholest-7-en-6-one ...
-
No products found
because this supplier's products are not listed.
Mario Figueroa, et al.,
bioRxiv - Physiology 2023
Quote:
... and SGK-1KO VSMCs from culture passages 2-10 were seeded at a density of 5000 cells per cm2 into amino coated Bioflex-6 well plates (BF-3001A; Flexcell International Corporation ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
Thomas R. Gawriluk, et al.,
bioRxiv - Immunology 2019
Quote:
... one of the 8 mm biopsies was placed into 10% (v/v) neutral buffered formalin (American MasterTech, McKinney, TX) overnight ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Stephen J. DeCamp, et al.,
bioRxiv - Biophysics 2020
Quote:
Polymerized polyacrylamide gels were first treated with 440 μL of a 1:50 (v/v) mixture of Sulfosuccinimidyl 6-(4'-azido-2'-nitrophenylamino)hexanoate (Sulfo-SANPAH) (ProteoChem) and 50 mM HEPES solution under a UV light for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Qiong Wang, et al.,
bioRxiv - Immunology 2019
Quote:
One immunization to induce CIA : Bovine type II collagen (2 mg/ml, Chondrex, cat. # 20021) and complete Freund’s adjuvant (4mg/ml M ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... A 5’-amino modifier (Glen Research) was coupled onto the end of sequences for subsequent conjugation with the polymer ...
-
No products found
because this supplier's products are not listed.
Mary S. Dickinson, et al.,
bioRxiv - Immunology 2022
Quote:
... supplemented with 9% heat inactivated FBS (Omega Scientific) and non-essential amino acids (Gibco 11140-050) ...
-
No products found
because this supplier's products are not listed.
Vineet Choudhary, et al.,
bioRxiv - Cell Biology 2020
Quote:
... an amino acid mix (United States Biologicals), containing either 2% glucose ...
-
No products found
because this supplier's products are not listed.
Lu Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult mice of 6-8 weeks were anaesthetized (i.p. 100mg/kg sodium pentobarbital) and mounted on a stereotaxic frame (RWD Life Science, Shenzhen, China). Virus suspension (AAV9-CaMKII-mCherry ...
-
No products found
because this supplier's products are not listed.
Johannes Yayo, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Waters amino acid standard solution with 17 amino acids (cat. no. WAT088122) was mixed with glutamine (Irvine Scientific, Tilburg, The Netherlands), asparagine ...
-
No products found
because this supplier's products are not listed.
Mikala C. Mueller, et al.,
bioRxiv - Bioengineering 2023
Quote:
Poly(ethylene glycol)-hydroxyl (PEG-OH; 8-arm, 10 kg mol−1; JenKem Technology) was dissolved in anhydrous tetrahydrofuran (THF ...
-
No products found
because this supplier's products are not listed.
XY Sun, TZ Zhang, LX Cheng, W Jiang, YH Sun,
bioRxiv - Molecular Biology 2022
Quote:
... or 8 μg anti-Myc antibody (Abbkine, A02040) or 8 μg anti-Myc antibody (Transgen Biotech ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Emily G. Kuiper, et al.,
bioRxiv - Biochemistry 2019
Quote:
... aeruginosa PAO1 EF-Tu (tufB) coding sequence from plasmid pJP04 (9) into the pE-SUMO vector (LifeSensors). This construct produces His6-SUMO-EF-Tu protein (“SUMO-L0-EF-Tu” ...
-
No products found
because this supplier's products are not listed.
Alexis Casciato, et al.,
bioRxiv - Physiology 2022
Quote:
... concomitantly with DAPI at 1:1000 (Immunochemistry technologies, 2 hours, room temperature). They were then washed ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Arun Sharma, et al.,
bioRxiv - Cell Biology 2020
Quote:
... SARS-CoV-2 double stranded RNA (1:100, J2 clone; Absolute Antibody Inc.); cleaved caspase-3 (1:200 ...
-
No products found
because this supplier's products are not listed.
Maitreyi S. Joshi, et al.,
bioRxiv - Systems Biology 2022
Quote:
... atto-590azide (6 mM, ATTO-TEC GmbH, Siegen, Germany) dissolved in DMSO was mixed with aqueous solution of click-chemistry grade CuSO4 (40mM ...
-
All viral vectors
Cat# KC30600,
ViroMag 100µL + ViroMag RL 100µL + AdenoMag 100µL + Magnetic Plate MF10000, USD $715.00/KIT
Ask
Yuan-Chen Tsai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... were mixed with 2 μl lipofectamine 2000 (Thermo Fischer Scientific) and 1 μl (1:10 diluted) magnetofection beads (CombiMag, OZ Bioscience). The plasmid-lipofectamine-magnetofection mix were incubated at room temperature for 15 min before adding to neurons ...
-
No products found
because this supplier's products are not listed.
Iliodora V. Pop, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Mice (1-2 months old) were injected with 4% (w/v) FG solution in saline (Fluorochrome). Mice were anesthetized with isoflurane and the area above and around the cerebellar region was prepared for surgery ...
-
No products found
because this supplier's products are not listed.
Soma Ray, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... HLAG+ EVTs were depleted from the cell suspension by immune-purification using HLA-G PE labeled antibodies (Exbio Clone MEM-G/9, 1P-292-C100), PE MACS beads (Miltenyi biotec 130-048-801 ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Glenn F. W. Walpole, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PtdIns(3,4)P2 (Echelon Biosciences P-3416-2); PtdIns(3,4,5)P3 (Echelon Biosciences P-3916-2) ...
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...