-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
Cat# 476330-17-3,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1050,
Inquiry
Ask
Shuangfen Tao, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... We purchased Target sequences for Bcl-2 miRNA 3’-UTR clone and the one with a site mutation at miR-383-binding site from Creative Biogene (Shirley, NY, USA). We seeded MiR-383-modified cells of GC in 24-well plates ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 2H,2H,3H,3H-Perfluorooctane-1-sulfonate (6:2 FTSA, CAS 59587-39-2, purity ≥ 97%) were from Synquest Laboratories (Alachua, FL). HSA (CAS 70024-90-7 ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
Hexokinase-1/2/3 (HK1/2/3) Antibody is a Mouse Monoclonal antibody against Hexokinase-1/2/3 (HK1/2/3).
Cat# abx137731-5UG,
5 µg USD $261.0
Ask
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Anti-hTERT mAb (clone 10E9-2: MBL Co., Ltd., M216-3) and anti-hTERT sheep pAbs (Abbexa Ltd., abx120550) were used for immunoprecipitation (IP).
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Laurence Abrami, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 2-Bromopalmitate (2-BP; Focus Biomolecules, FBM-10-3284) at 100 μM at 37°C during the indicated time.
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Lisa Maria Metz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... GPIbα (CD42b, Xia.G5-PE, #M040-2 Emfret Analytics, 1:10), GPVI (JAQ1-FITC ...
-
No products found
because this supplier's products are not listed.
Sara M. Eslami, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Quartz spectrophotometer cell (Starna Cells, cat. no. 1-Q-2) and measured using an Olis Cary-16 circular dichroism spectrometer ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Piotr T. Wysocki, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and MCDB-105 (Cell Applications, San Diego, CA, USA; ratio 2:1:1). Culture media were supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Ivar Noordstra, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 2% Albumin (Sanquin Bloodbank, the Netherlands), 10 mM nicotinamide (prepared by the LUMC pharmacy) ...
-
No products found
because this supplier's products are not listed.
Alina Guna, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the cells were transferred to 1-2 L roller bottles (Celltreat, USA) and grown in a shaking incubator operating at 8% CO2 and rotating at 125 rpm ...
-
No products found
because this supplier's products are not listed.
Alexis Casciato, et al.,
bioRxiv - Physiology 2022
Quote:
... concomitantly with DAPI at 1:1000 (Immunochemistry technologies, 2 hours, room temperature). They were then washed ...
-
No products found
because this supplier's products are not listed.
Gong-Her Wu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Quantifoi®l R 2/2 Micromachined Holey Carbon grid: 200 mesh gold (SPI supplies Cat#:4420G-XA) grids were prepared for cell plating by sterilizing using forceps to carefully submerge them in 100% ethanol (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Abhichart Krissanaprasit, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2 mg/mL fibrinogen (Enzyme Research Laboratories), 0.1 mg/mL Alexa-Fluor 488 labeled fibrinogen for visualization (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mouse anti-SERT (ST51-2; Mab Technologies), rabbit anti-HA (C29F4 ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Javier Martínez Pacheco, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Rabbit AtTOR polyclonal antibodies (Abiocode, R2854-2), rabbit polyclonal S6K1/2 antibodies (Agrisera ...
-
No products found
because this supplier's products are not listed.
Ryan J. Garrigues, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2% C1q-depleted serum (LP; Complement Technologies), or 20% NHS (AP ...
-
No products found
because this supplier's products are not listed.
Gayani Wijegunawardena, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2-chlorotrityl resin was purchased from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Ann Cirincione, et al.,
bioRxiv - Genomics 2024
Quote:
... pALD-VSV-G-A (2 μg, Aldevron), and the transfer vector (15 μg ...
-
No products found
because this supplier's products are not listed.
Alexander von Appen, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat α-Tubulin (YL1/2; Accurate Chemical & Scientific), SUN1 (ab124770 ...
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Ovaries from 3-day matured flies were dissected one at a time in Halocarbon oil (700; Halocarbon) on a cover slip ...
-
No products found
because this supplier's products are not listed.
Yan Jin, et al.,
bioRxiv - Physiology 2024
Quote:
... Mice were given a single 330 μg/kg dose of a synthetic growth hormone releasing peptide-2 (GHRP-2; #OPPA01036, Aviva Systems Biology) by intra-peritoneal (i.p. ...
-
No products found
because this supplier's products are not listed.
Diwakar Turaga, et al.,
bioRxiv - Bioengineering 2020
Quote:
Cardiac microtissues stained for GATA4 and labeled with Hoechst were suspended in size 2 glass capillaries (Zeiss; ∼1mm inner diameter) in 2% low-melt agarose (made up in PBS; IBI Scientific, Dubuque, IA) immediately prior to imaging (Supplementary Figure 1) ...
-
Native Antigen
Cat# NAT41589-100,
100µg USD $426.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Alison C. Leonard, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... TIF was isolated using a UF-1-2 In Vivo Ultrafiltration Sampling Probes (BASI, MF-7027). The probe was implanted centrally into the tumor for 2h to collect TIF ...
-
No products found
because this supplier's products are not listed.
Yue Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and/or distribution of puncta was quantified in the 3-D volume using Volocity software (Quorum Technologies, Ontario, Canada) or Imaris software (Oxford Instruments ...
-
No products found
because this supplier's products are not listed.
Jennifer O’Brien, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and chicken anti-beta-tubulin 3 (Aves Labs, TUJ-0020, 1:500).
-
No products found
because this supplier's products are not listed.
Annelien Morlion, et al.,
bioRxiv - Genomics 2021
Quote:
... gDNA heat-and-run removal was performed by adding 1 μl HL-dsDNase (ArcticZymes #70800-202, 2 U/μl) and 0.68 μl reaction buffer (ArcticZymes #66001 ...
-
No products found
because this supplier's products are not listed.
Tilman Busch, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... The analytical column was self-packed with silica beads coated with C18 (Reprosil Pur C18-AQ, d = 3 Â) (Dr. Maisch HPLC GmbH, Ammerbusch, Germany). For peptide separation ...
-
Cat# G209,
USD $10.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Etai Sapoznik, et al.,
bioRxiv - Biophysics 2020
Quote:
... #1.5 coverslips (0420-0323-2, Bioptechs) were washed at room temperature in solution consisting of 1:1 (vol/vol ...
-
No products found
because this supplier's products are not listed.
Neil P. Blackledge, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... anti-PCL2 (GenWay GWB-FA7207, 2 μl), or anti-PCGF6 (3 μl) ...
-
No products found
because this supplier's products are not listed.
Diego A. Vargas-Blanco, et al.,
bioRxiv - Microbiology 2019
Quote:
... transferred to 2 mL disruption tubes (OPS Diagnostics 100 μm zirconium lysing matrix ...
-
No products found
because this supplier's products are not listed.
Arina V. Drobysheva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
For phi14:2 RNAP transcription assay genomic DNA of phi14:2 was purified using the Phage DNA Isolation Kit (Norgen Biotek Corp) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shannan P. McClain, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 minutes later at 2 µM elenterazine (Prolume Ltd) was added and luminescence (490 to 410 nm ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus alkaline lignin was degraded by microwave solvolysis using a mixture (15 mL) of deuterated acetic acid and D2O (2:1) containing 1 mM TsCl in a microwave reactor (Biotage Initiator Plus) at 160° C for 30 min (Entry 22) ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...