-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
No products found
because this supplier's products are not listed.
Yan Tang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... the small molecule 3-[2-[(4-Fluorophenyl)methyl]imidazo[2,1-b]thiazol-6-yl]-2H-1-benzopyran-2-one (iMDK; TOCRIS Bio-techne, 9mg/kg), rapamycin (Sirolimus A8167 ...
-
No products found
because this supplier's products are not listed.
Sarah Easson, et al.,
bioRxiv - Physiology 2022
Quote:
... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
No products found
because this supplier's products are not listed.
Nienke Willemsen, et al.,
bioRxiv - Pathology 2022
Quote:
... and Proteasome 20S alpha 1+2+3+5+6+7 (Abcam, ab22674). After washing with TBS-T (200 mM Tris (Merck) ...
-
No products found
because this supplier's products are not listed.
Ana Cláudia Raposo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100, Santa Cruz), 5-(hydroxymethyl)-2′-deoxycytidine-2H3 (#H946632 ...
-
No products found
because this supplier's products are not listed.
Masaki Tsuchiya, et al.,
bioRxiv - Cell Biology 2022
Quote:
... [2-[(Methylthio)(2H-pyrrol-2-ylidene)methyl]-1H-pyrrole](difluoroborane) (TCI, M2609) was reacted with dibenzocyclooctyne-amine (TCI ...
-
No products found
because this supplier's products are not listed.
Mesfin Meshesha, et al.,
bioRxiv - Bioengineering 2023
Quote:
Pyrrole (C4H5N) 98.0% (Merck, Germany) was vacuum distilled before use ...
-
No products found
because this supplier's products are not listed.
Sebastian Duno-Miranda, et al.,
bioRxiv - Molecular Biology 2023
Quote:
The fluorescence of 3’-O-(N-Methyl-anthraniloyl)-2’-deoxyadenosine-5’-triphosphate (mantATP) (Jena Biosciences) was measured with 290 nm excitation and a 395 nm long-pass emission filter in a stopped-flow apparatus (Applied Photophysics ...
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Patrick T Griffin, et al.,
bioRxiv - Genomics 2022
Quote:
... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
No products found
because this supplier's products are not listed.
Sachithrani U. Madugalle, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Luisa Saecker, Hanns Häberlein, Sebastian Franken,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... 1-[2-chloro-6-[[(3-iodophenyl)methyl]amino]-9H-purin-9-yl]-1-deoxy-N-methyl-β-D-ribofuranuronamide (2-Chloro-IB-MECA; Cayman Chemicals, 163042-96-4), [2-Amino-4-[3-(trifluoromethyl)phenyl]-3-thienyl] phenylmethanone (VCP 171 ...
-
No products found
because this supplier's products are not listed.
Delphine M Depierreux, et al.,
bioRxiv - Microbiology 2021
Quote:
... ULBP-2/5/6 (65903, R&D systems), Plexin-B1 (rea728 ...
-
No products found
because this supplier's products are not listed.
M.T. Jahn, et al.,
bioRxiv - Microbiology 2019
Quote:
... were transfected with 20 ng pNF-□B-Luc and 3 ng pRL-TK using FuGENE 6 (Roche). Transfected cells were incubated for 24 h (37°C ...
-
No products found
because this supplier's products are not listed.
Rodrigo Guabiraba, et al.,
bioRxiv - Immunology 2023
Quote:
... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Mariam Lotfy Khaled, et al.,
bioRxiv - Cancer Biology 2023
Quote:
3-methyl-2-oxovaleric acid sodium salt (KMV) (Toronto Research Chemical), 4-methyl-2-oxovaleric acid (KIC ...
-
No products found
because this supplier's products are not listed.
Sapir Herchcovici Levi, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (PeproTech, SM-2520691-B) and 0.2 µM PD0325901 (PeproTech ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-diaminobenzidine plus nickel (DAB; Vector Laboratories Kit; 2-5 min reaction). Sections were analyzed with an Olympus BX51 upright microscope ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Tuce Tombaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Shan Qi, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 µM [methyl-3H] S-adenosyl methionine (PerkinElmer), 10 µM substrate RNA/DNA probe ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Dougald M. Monroe, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 μM lipid vesicles (Avanti Polar Lipids PS:PC:PE 3:2:5), and FV (0 ...
-
No products found
because this supplier's products are not listed.
Mehdi Benlarbi, et al.,
bioRxiv - Microbiology 2024
Quote:
... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
No products found
because this supplier's products are not listed.
Marin Boutonnet, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2-methyl-6-(phenylethynyl)-pyridine hydrochloride (MPEP, HelloBio®); human angiotensin II (HelloBio®) ...
-
No products found
because this supplier's products are not listed.
Andrea Tagliani, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
No products found
because this supplier's products are not listed.
Helena Shomar, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Katarzyna Wacnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 µl of 1 M NaOH and 6 µl of Cell-Tak (Corning, 5% (w/v) in acetic acid ...
-
No products found
because this supplier's products are not listed.
Bethany A Stahl, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Embryos were mounted in 3% hydroxypropyl methyl cellulose (VWR, cat# 200012-722) in E3 medium (ref) ...
-
No products found
because this supplier's products are not listed.
Huan Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-B cell lymphoma-2 (Bcl-2) (Cell Signaling Technology, USA, #3498S) and anti-CCAAT enhancer binding protein-α (CEBP-α ...
-
No products found
because this supplier's products are not listed.
Shounak Banerjee, et al.,
bioRxiv - Biophysics 2022
Quote:
... 20% Pyrrole (prepared as solution in DMF) was obtained from Alfa Aesar (USA). Pyrrole is the suggested Fmoc deprotection reagent by CEM ...
-
No products found
because this supplier's products are not listed.
Zackary Sabetta, et al.,
bioRxiv - Neuroscience 2023
Quote:
A total of 64 young adult age-matched male and naturally cycling female Sprague-Dawley rats (~3 months old; males 367 ± 3 g and females 235 ± 1.5 g; n = 5-6/group; Envigo, Indianapolis, IN, USA) were used in these experiments and maintained in a 12:12 h light:dark cycle in a temperature and humidity-controlled room ...
-
No products found
because this supplier's products are not listed.
Martin H. Berryer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 5 mL N2 supplement B (StemCell Technologies, 07156)] supplemented with SB431542 (10 µM ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Daniel F. Comiskey Jr., et al.,
bioRxiv - Cancer Biology 2019
Quote:
2’O-methyl SSOs were provided by Trilink BioTechnologies ...
-
Cat# HY-111644,
inquire
Ask
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PF-04957325 (3-[[(2R)-4-(1,3-thiazol-2-ylmethyl)morpholin-2-yl]methyl]-5-(trifluoromethyl)triazolo[4,5-d]pyrimidin-7-amine) was purchased from MedChemExpress (Monmouth Junction, NJ). Unless otherwise indicated ...
-
No products found
because this supplier's products are not listed.
Samantha G Zambuto, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Cells were fixed 6 hours and 3 days after seeding and imaged in brightfield using a Leica DMI 4000 B microscope (Leica Microsystems).
-
No products found
because this supplier's products are not listed.
Sayantani Pramanik Palit, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The treatment was continued daily for 6 weeks along with 5-bromo-2’-deoxyuridine (BrdU) (MP Biomedicals, India) on alternative days (100mg/kg bw i.p.) ...
-
No products found
because this supplier's products are not listed.
Amin Zargar, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... 5-methyl-6-(propan-2-yl)oxan-2-one was synthesized by Enamine (Cincinnati, USA) to greater than 95% purity.
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Manu De Groeve, Bram Laukens, Peter Schotte,
bioRxiv - Microbiology 2023
Quote:
... 2 L or 5 L scale (Biostat B-plus and B-DCU units, Sartorius Stedium Biotech) as previously described [PMID ...
-
No products found
because this supplier's products are not listed.
Abishek Chandrashekar, et al.,
bioRxiv - Microbiology 2022
Quote:
... SARS-CoV-2 (B.1.1.529) RBD proteins (Sino Biological) labeled with APC and DyLight 405 ...
-
No products found
because this supplier's products are not listed.
Maude Jans, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Fixative was removed by washing 5 x 3 min in 0.1 M cacodylate buffer and samples were incubated in 2% osmium (OsO4, EMS) in 0.1 M cacodylate buffer for 30 min at RT ...