-
No products found
because this supplier's products are not listed.
Roberto Balbontín, Nelson Frazão, Isabel Gordo,
bioRxiv - Microbiology 2020
Quote:
... In the competitions including the RNase HI inhibitor 2-[[[3-Bromo-5-(2-furanyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidin-2-yl]carbonyl]amino]-4,5,6,7-tetrahydro-benzo[b]thiophene-3-carboxylic acid ethyl ester (RHI001, Glixx Laboratories Inc., catalog number GLXC-03982), the medium was supplemented with 500 µM of RHI001 ...
-
No products found
because this supplier's products are not listed.
Linghao Hu, et al.,
bioRxiv - Bioengineering 2022
Quote:
... bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl) ethyl sulfide (BPTES, 10 μm, ASTATECH, A11656) was added to the cells in CM3 1 hour before imaging (35) ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Physiology 2023
Quote:
... and total glucagon-like peptide-1 (GLP-1) in both the 7-36 and 9-36 forms (Cat #43-GPTHU-E01 ALPCO). For insulin ...
-
No products found
because this supplier's products are not listed.
Soma Ray, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... HLAG+ EVTs were depleted from the cell suspension by immune-purification using HLA-G PE labeled antibodies (Exbio Clone MEM-G/9, 1P-292-C100), PE MACS beads (Miltenyi biotec 130-048-801 ...
-
No products found
because this supplier's products are not listed.
Christophe Michel Raynaud, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... EZ Standard Pack 2 (Protein simple, #PS- ST02EZ-8) and Anti-mouse detection module (Protein simple DM-002) ...
-
No products found
because this supplier's products are not listed.
Michael Manoharan Valerio, et al.,
bioRxiv - Immunology 2023
Quote:
... and selected with 10 ug/mL of Blasticidin (AG Scientific #3513-03-9). Guide-RNA sequences targeting mouse β2m ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Justine Cristante, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... or pTer1 control vector (pTer1 cells)16 were authenticated by CellCheck human 16 Plus Test (9 human STR marker profile + 7 additional Human STR marker, Inter-species contamination Test and STAT-mycoplasma testing) (IDEXX Analytics). They were grown in Dulbecco’s Modified Eagle Medium:F-12 (DMEM/F-12 Glutamax ...
-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Adam C Palmer, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... with ClonTracer plasmid (10 μg per 10 cm dish) and lentiviral packaging and VSV-G plasmids psPAX2 and pMD2.G (Cellecta CPCP-K2A; 10 μg of mix per 10 cm dish). Supernatants of transfected HEK293T cells were harvested at 48 h and again at 72 h post-transfection ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
Oju Jeon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... treated with activated charcoal (5 g/L, 100 mesh, Oakwood Chemical) for 30 min ...
-
No products found
because this supplier's products are not listed.
Ermelinda Porpiglia, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mice (8-10 weeks) were acutely injured by a single 10 μl intramuscular injection of notexin (10 μg/ml; Latoxan, France) into the TA muscle and two injections in the GA muscle at the indicated time points.
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Kirill Gorshkov, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... is transferred into empty wells in columns 3 and 13 of an Echo® Qualified 384-Well Polypropylene Source Microplate (Labcyte P-05525). Compounds are diluted 2-fold by transferring 40 μL of each sample into 40 μL DMSO in the adjacent well (columns 4 and 14 ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Activation buffer consisting of 10 mg/ml 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (C1100, ProteoChem) and 10 mg/ml Sulfo-N-hydroxysulfosuccinimide (Sulfo-NHS ...
-
No products found
because this supplier's products are not listed.
de la O Sean, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... + 0.22 g glucose (MilliporeSigma, G7528) + 1.23 g sodium bicarbonate (MilliporeSigma, S5761) + 10 g fatty-acid free bovine serum albumin (FAF-BSA) (Lampire Biological Laboratories, 7500812) + 10 μL Insulin-Transferrin-Selenium-Ethanolamine (ITS-X ...
-
No products found
because this supplier's products are not listed.
Autumn R Tobin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 10 μL of 5 mM D-biotin (Avidity) were added to the protein along with BirA ligase ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Fulai Zhou, et al.,
bioRxiv - Biophysics 2021
Quote:
Spodoptera frugiperda 9 (Sf9) insect cells (Expression Systems) were grown in ESF 921 serum-free medium (Expression Systems ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Kevin G. Burt, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 20 ng/mL IL-13(Shenandoah Biotech, Cat #200-22). Cells cultured with complete macrophage media was used as M0 group.
-
No products found
because this supplier's products are not listed.
Robert Wimbish, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Silanized coverslips were incubated with a rat anti-tubulin antibody (8 μg/ml, YL1/2; Accurate Chemical & Scientific Corporation) for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Thomas R. Gawriluk, et al.,
bioRxiv - Immunology 2019
Quote:
... one of the 8 mm biopsies was placed into 10% (v/v) neutral buffered formalin (American MasterTech, McKinney, TX) overnight ...
-
No products found
because this supplier's products are not listed.
Alexa M. Schmitz, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... was cultured in yeast peptone mannitol (YPM; 5 g L-1 yeast extract (C7341, Hardy Diagnostics, Santa Maria, CA), 3 g L−1 peptone (211677 ...
-
No products found
because this supplier's products are not listed.
Marissa D. Acciani, et al.,
bioRxiv - Microbiology 2020
Quote:
... followed by a 2 hour incubation with antibodies against VSV-G (1:200, Alpha Diagnostic International, VSIG11-S) or EBOV-GP (1:50 ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Waku, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... After the treatment with 5 nM or 10 nM bortezomib (BTZ, Peptide Institute), the cells were stained by Trypan Blue and automatically counted using a TC20 Automated Cell Counter (Bio-Rad Laboratories).
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Ruben Shrestha, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and sec seedlings were grown on Hoagland medium containing 14N or 15N isotope salt (1.34 g/L Hoagland’s No. 2 salt mixture without nitrogen (Caisson labs), 6 g/L Phytoblend ...
-
No products found
because this supplier's products are not listed.
Benjamin P. Brown, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... L747_A750>P (#E10-12MG, lot G1200-3), and L747_E749 (#E10-12LG, lot G1344-5) were purchased from SignalChem. The Promega ADP-Glo™ kinase assay kit was used to quantify the amount of ADP produced by each EGFR variant in 1XBFA buffer and in the presence or absence of erlotinib at varying concentrations ...
-
No products found
because this supplier's products are not listed.
Margot de Looff, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... A549-Src-KO cells served as a non-specific binding control The protein mixtures were loaded on a RunBlue 1 mm*10 well 8%-Bis-Tris – gel (Expedeon, Cambridge, UK) after heating the mixture at 70°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Georgios I. Laliotis, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The RNA pellet was washed with 75% ethanol followed by spin at 7,500 x g for 5 min at 4 °C and dissolved in 30 µl DEPC-treated water (IBI Scientific, Cat. No. IB42210). Protein extraction ...
-
No products found
because this supplier's products are not listed.
Yu-Ling Lin, et al.,
bioRxiv - Neuroscience 2022
Quote:
The cannula for implantation consisted of the guide cannula (27-G, 0.41 mm in diameter and 5 mm long; RWD Life Science, Shenzhen, China) and dummy cannula (0.2 mm in diameter and 5.5 mm long ...
-
No products found
because this supplier's products are not listed.
Masaru Nakao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... operated with an LDI-7 Laser Diode Illuminator (Chroma Technologies Japan ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Virginia Savy, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3-week-old females were primed by intraperitoneal injection of 5 IU of equine chorionic gonadotropin (Lee Biosolutions, Maryland Heights, MO) followed 46–48 h later by 5 IU human chorionic gonadotropin (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Venecia Valdez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 200 μM PMSF) before flowing over 5 mL CV of Strep-Tactin Superflow resin (Neuromics: 2-1206-025). The column was then washed with 10 CV of Strep binding buffer before being eluted with 1.5 CV of elution buffer (Strep binding buffer + 3.3 mM D-desthiobiotin) ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... Fisher Scientific; 1327-53-3), As(V) (Arsenic V Speciation Standard, Fisher Scientfic; 7732-18-5, AsB (Arsenobetaine Standard Solution, LGC Standards; NIST-3033), DMA (Dimethylarsinic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Joanna Domagala, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MCF-7 cells were seeded on 16-well E-Plates (ACEA Biosciences) at a cell density 3 × 104 per well in 150 μl of the DMEM medium and monitored for 24h ...
-
No products found
because this supplier's products are not listed.
Shail Kabrawala, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Affinity-purified chicken anti-WHIMP antibodies were generated against mouse WHIMP amino acids 9-21 (Aves Labs). Other antibodies were rabbit anti-MBP [68] ...
-
No products found
because this supplier's products are not listed.
Eirik R. Åsheim, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... Each individual’s body mass was then recorded to the nearest 0.01 g (April, July) and subsequently 0.1 g using a digital scale (Scout STX222 or STX6201, Ohaus, Parsippany, USA). Fork length (length from snout to fork of tail ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Kawano, et al.,
bioRxiv - Neuroscience 2019
Quote:
... in two stages and using a vertical pipette puller (PB-7, Narishige International USA). The resistance of the recording electrode was 5-7 MΩ ...
-
No products found
because this supplier's products are not listed.
Luke A. Pattison, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 10 µl complete Freund’s adjuvant (CFA, 10 mg/ml, Chondrex) or saline was injected unilaterally (ipsilateral knee randomly determined) ...