-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Aline Sardinha-Silva, et al.,
bioRxiv - Immunology 2024
Quote:
... and/or with 10 μg of both combined recombinant mouse IL-4-Fc and IL-13-Fc (5 μg of each) (Absolute Antibody) every other day for 10 days (5 treatments) ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Uxia Gurriaran-Rodriguez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... After 6h of transfection cells were treated overnight with PORCN inhbibitor diluted in DMSO (AdooQ) at two different concentrations 100nM and 500nM in fresh media ...
-
No products found
because this supplier's products are not listed.
Hannes Maib, David H. Murray,
bioRxiv - Cell Biology 2021
Quote:
... were produced by mixing 95 mol % 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) with 5 mol % of the respective phosphatidylinositol together with 0.1% Atto647N-DOPE (ATTO-TEC) or Rhodamine-DOPE ...
-
No products found
because this supplier's products are not listed.
Guillermo Najarro, et al.,
bioRxiv - Microbiology 2023
Quote:
... vIL6 (Advanced Biotechnology 13-214-050), KbZip (SCBT sc-69797) ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Lena H. Nguyen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... p-4E-BP1/2/3-Thr45 (Bioss Antibodies bs-6421R, 1:200, 1:500), anti-HCN4 (Alomone Labs APC-052 ...
-
No products found
because this supplier's products are not listed.
Marisa M. Brockmann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... neurons were incubated in 10 nM 5 nm Ni-NTA-Nanogold (Nanoprobes) (Chang et al. ...
-
No products found
because this supplier's products are not listed.
Xiaofeng Zheng, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Total blood was centrifuged at 10,000 x g for 10 min and the supernatant (serum) was collected for insulin measurements using Mouse Insulin ELISA (Mercodia).
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Andrew R Harris, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 5% biotinyl-amino-PEG (Rapp Polymere, #13 3000-25-20) which was incubated for a minimum of 4 hours at 50°C ...
-
Cat# 18556-27-9,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rats received one intraperitoneal injection of 5-Ethynyl-2’-deoxyuridine (EdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 61135-33-9) and were killed 6 (CTL n = 8 ...
-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
No products found
because this supplier's products are not listed.
W. Patrick Bewg, et al.,
bioRxiv - Plant Biology 2021
Quote:
... with 3 g/L gellan gum (PhytoTechnology Lab) as a gelling agent ...
-
No products found
because this supplier's products are not listed.
Ann Cirincione, et al.,
bioRxiv - Genomics 2024
Quote:
... pALD-VSV-G-A (2 μg, Aldevron), and the transfer vector (15 μg ...
-
No products found
because this supplier's products are not listed.
Jian He, et al.,
bioRxiv - Immunology 2022
Quote:
... with 10 μl/g liposome-clodronate (Liposoma) once a day for two days prior to experiment.
-
No products found
because this supplier's products are not listed.
Tianyang Yan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Cells were then incubated with 10 µg/mL Dil-LDL (Kalen Biomedical, 770230-9) for 50 min ...
-
No products found
because this supplier's products are not listed.
Joanna M. Cooper, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Wild-type Chinese hamster ovary (WT CHO) and CHO 13-5-1 cells (FitzGerald et al., 1995) were maintained in DMEM/Ham’s F12 with L-glutamine (DMEM/F12 ...
-
No products found
because this supplier's products are not listed.
Saurav Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... pMD2.G and psPAX2 in 2:1:2 ratio with PolyJet transfection reagent (SignaGen Laboratories). Media were harvested two days later and added to recipient cells with 1 μg/ml polybrene (Sigma ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
Mohummad Aminur Rahman, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Elise H. Zimmerman, et al.,
bioRxiv - Microbiology 2023
Quote:
... samples were centrifuged at 6,000 x g for 7 minutes then resuspended in RNAzol RT (Molecular Research Center). Samples then underwent RNA extraction ...
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP) was obtained from Moravek biochemicals ...
-
No products found
because this supplier's products are not listed.
John P Stone, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Human sC5b-9 (Complement Technology) at concentration ranging from 5 μg/mL to 0.01 μg/mL was used to generate a standard curve ...
-
magnetofection
Neurons transfection
Cat# KC30800,
NeuroMag 200µL + Magnetic Plate MF10000, USD $645.75/KIT
Ask
Amanda K. Hund, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 3) 10ul of Alum (2% Alumax Phosphate, OZ Bioscience) + 10ul PBS (alum treatment) ...
-
No products found
because this supplier's products are not listed.
Diane C. Saunders, et al.,
bioRxiv - Cell Biology 2020
Quote:
... were washed 3 times with 2 mM EDTA in 10 mM PBS and then dispersed by incubating with Accutase (Innovative Cell Technologies) at 37°C for 10 minutes with constant pipetting ...
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
because this supplier's products are not listed.
Vanessa Simões, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 2-10 µM of ubiquitin (LifeSensors si201), 10 µg of isolated ribosomes ...
-
No products found
because this supplier's products are not listed.
Jiuxin Qu, et al.,
bioRxiv - Microbiology 2019
Quote:
... These were grown with a lid for 9 - 10 hours on a plate shaker (OrbiShaker MP, Benchmark Scientific, NJ) at 37°C and 900 rpm ...
-
No products found
because this supplier's products are not listed.
Ankita M. George, et al.,
bioRxiv - Microbiology 2021
Quote:
Sequences were assembled in SeqMan Pro 13 (DNASTAR). Assembled sequences were compared through the using BLASTn (NCBI ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marilyn E. Allen, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 8-10 kDa molecular weight cut off (MWCO) was purchased from Repligen (Waltham, MA, USA). TLR agonists (ssRNA40/LyoVec and CpG-A ODN 2216 ...
-
No products found
because this supplier's products are not listed.
Daniel Egert, et al.,
bioRxiv - Bioengineering 2020
Quote:
... blocked and incubated for 7-10 days at room temperature with both primary antibodies Rb ∝ mOR (ImmunoStar 24216) and Ms ∝ NeuN (Millipore MAB377) ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Akanksha Thawani, et al.,
bioRxiv - Cell Biology 2020
Quote:
... An objective heater collar was attached (Bioptechs, model 150819-13) and the temperature set-point of 33.5°C was used for experiments ...
-
No products found
because this supplier's products are not listed.
Jinbao Liu, et al.,
bioRxiv - Plant Biology 2024
Quote:
... Then the mixture was centrifuged at 200 g for 2 min and the supernatant was transferred to a new 2 mL Tube (CELLTREAT, catalog number: 229446) and centrifuged at 1,000 g for 5 min ...
-
No products found
because this supplier's products are not listed.
Büsra Güngör, et al.,
bioRxiv - Biochemistry 2021
Quote:
... before resuspending in 6.7 ml per g wet weight in MP2 (20 mM KPi buffer pH 7.4, 1.2 M sorbitol, 3 mg per g wet weight zymolyase from Seikagaku Biobusiness) and incubated at 30°C for 60 min ...
-
No products found
because this supplier's products are not listed.
Seung Jae Shin, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 100 ng/mL Phorbol 12-myristate 13-acetate (PMA; BioGems, #1652981) was added ...
-
No products found
because this supplier's products are not listed.
Raife Dilek Turan, et al.,
bioRxiv - Immunology 2021
Quote:
5 μg / ml of SARS-COV-2 Spike S1 Monoclonal Antibody (ElabScience) antibodies were added in the gel at a concentration of 2% ...
-
No products found
because this supplier's products are not listed.
Jiangtao Liang, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 5–7-day-old adult females were blood-fed using artificial blood feeders with defibrinated sheep’s blood (HemoStat Laboratories Inc., CA, USA). Egg dishes were placed in cages for oviposition approximately two to three days after blood feeding.
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Blots were blocked in TBS buffer (10 mmol/L Tris-HCl, pH 8, 150 mmol/L NaCl, Boston Bioproducts) containing 5% (w/v ...
-
No products found
because this supplier's products are not listed.
Marzia Rizzo, et al.,
bioRxiv - Microbiology 2021
Quote:
... and a volume equivalent to an OD600 of 7 was washed in 50 mM EDTA and resuspended in 20 µl of 10 mg/ml Zymolyase 100T (Amsbio #120493-1) and 300 µl of 1% Low Melt agarose (Biorad® # 1613112 ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5 - 10 mL of washed single donor human RBCs in Alsever’s solution (Innovative Research Inc) were added to a 50ml conical tube ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 8 ng/mL Cholera Toxin (CELL technologies), 5 ng/mL insulin (CELL technologies) ...
-
No products found
because this supplier's products are not listed.
Iosifina P. Foskolou, et al.,
bioRxiv - Immunology 2022
Quote:
... the human KDM4C enzyme (8 nM, BPS Bioscience) was incubated with the substrate of H3(1-21 ...
-
No products found
because this supplier's products are not listed.
Kyle E. Landgraf, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... one vial of cryopreserved cells was thawed and added to 10 ml T cell medium “TCM” (TexMACS medium, Miltenyi 130-097-196; 5% human AB serum, Valley Biomedical #HP1022 ...
-
No products found
because this supplier's products are not listed.
Mehdi Ghram, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and maintained as U2OS cells with addition of G-418 (1 mg/mL, Wisent Bioproducts). MSCV-pgk-GFP-eIF4E wildtype were used for retroviral transduction of NOMO-1 cells as in (Topisirovic et al 2003)14 ...