-
Cat# HY-N2207-5 mg,
5 mg, USD $220.0
Ask
Evan P.S. Pratt, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... PF-04957325 (3-[[(2R)-4-(1,3-thiazol-2-ylmethyl)morpholin-2-yl]methyl]-5-(trifluoromethyl)triazolo[4,5-d]pyrimidin-7-amine) was purchased from MedChemExpress (Monmouth Junction, NJ). Unless otherwise indicated ...
-
No products found
because this supplier's products are not listed.
Jihae Shin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The 5’ and 3’ end 2’-O-Methyl and phosphorothioate modified sgRNAs were synthesized by Genscript (Piscataway, NJ).
-
No products found
because this supplier's products are not listed.
Shaibu Oricha Bello, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Neutral red (3-amino-7-dimethylamino-2-methyl-phenazine hydrochloride) (Solarbio, cat. N8160), Minimal Essential Medium/Earls Balance Salts (MEM/EBSS ...
-
No products found
because this supplier's products are not listed.
Anderson R Frank, et al.,
bioRxiv - Cancer Biology 2022
Quote:
All lentiviruses were produced by co-transfection of HEK 293T/17 cells with plasmid DNA for the respective lentiviral vector and the packaging components psPAX2 and pMD2.G at a 5:3:2 mass ratio (vector:psPAX2:pMD2.G) using TransIT-LT1 (Mirus MIR 2300). Lentiviral supernatants were collected at 48 and 72 hours post-transfection ...
-
No products found
because this supplier's products are not listed.
Shiheng Zhang, et al.,
bioRxiv - Microbiology 2021
Quote:
... uniformly 15 N- and 13 C-labeled proteins were produced by growing cell cultures in M9 minimal medium that contained 1 g/l 15 N-ammonium chloride and 2 g/l 13 C-D-glucose (Cambridge Isotope Laboratories, Inc.) as the sources of nitrogen and carbon ...
-
No products found
because this supplier's products are not listed.
Kai Dünser, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) from Biotium (CA, USA), Wortmannin (WM ...
-
No products found
because this supplier's products are not listed.
Satoshi Matsui, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the dissociated cells were resuspended in the transduction medium (1 uL to 5 uL of lentivirus, 4 to 8 ug/ml Polybrane[STR-1003-G, Sigma Aldrich], and 10 uM Y27632 [72304, StemCell Technologies] in mTeSR1), and centrifuged at 3200 xg for 30 to 90 min ...
-
No products found
because this supplier's products are not listed.
Lisa G.M. van Baarsen, et al.,
bioRxiv - Immunology 2021
Quote:
... AEC (3-Amino-9-EthylCarbazole; Vector Laboratories, Burlingame, CA) was used as chromogen ...
-
No products found
because this supplier's products are not listed.
Pinelopi Pliota, et al.,
bioRxiv - Genetics 2022
Quote:
... 8 kb was done using g-TUBE (Covaris) following manufacturer protocols ...
-
No products found
because this supplier's products are not listed.
Bochuan Teng, et al.,
bioRxiv - Biophysics 2022
Quote:
... and analyzed with Clampfit 9 or 10 (Molecular Devices). Records were sampled at 5 kHz and filtered at 1 kHz ...
-
No products found
because this supplier's products are not listed.
Benjamin Furtwängler, et al.,
bioRxiv - Biochemistry 2021
Quote:
... supplemented with growth factors (Miltenyi Biotec, IL-3, IL-6 and G-CSF (10 ng/mL), h-SCF and FLt3-L (50 ng/mL) ...
-
No products found
because this supplier's products are not listed.
Tevye Jason Stachniak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and the brain was cut into 400-um thick coronal sections using a vibratome (Leica VT1000S; Leica, speed 5, vibration frequency 7-8), while in bubbling ice cold ACSF (recipe as above ...
-
No products found
because this supplier's products are not listed.
Haser Hasan Sutcu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 2 % Ultroser G (PALL)) and immediately seeded on cell dishes pre-coated with 0.1 mg/ml of Poly-D-Lysine (SIGMA ...
-
No products found
because this supplier's products are not listed.
Matthew Yedutenko, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Patch pipettes (resistance 7-8 MOhm, PG-150T-10; Harvard Apparatus, Holliston, Massachusetts) were pulled with a Brown Flaming Puller (Model P-87 ...
-
No products found
because this supplier's products are not listed.
Hang Xu, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... 8 and 9 (Enzo Life Sciences, Villeurbanne, France) at 37℃ for 2 h in the reaction buffer (50 mM Hepes (pH 7.5) ...
-
No products found
because this supplier's products are not listed.
Weicheng Peng, et al.,
bioRxiv - Biochemistry 2022
Quote:
... plated onto a LB (lysogeny broth; 10 g/L tryptone, 5 g/L yeast extract, and 10 g/L NaCl, Research Products International) agar plate with 50 μg/mL kanamycin ...
-
No products found
because this supplier's products are not listed.
Shreyas Krishnan, Richard L. Cryberg,
bioRxiv - Genetics 2019
Quote:
... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
Z-RLRGG-7-amino-4-methyl-courmarin (peptide-AMC) was purchased from Bachem. Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC ...
-
No products found
because this supplier's products are not listed.
Li-Qiang Chen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and a series of calibrated von Frey filaments (2, 4, 6, 8, 10, 15, 26 g, Stoelting Company, Wood Dale, Illinois, USA) were lightly applied to the skin within the infraorbital territory ...
-
No products found
because this supplier's products are not listed.
Khyati Girdhar, et al.,
bioRxiv - Microbiology 2022
Quote:
... This was followed by homogenization using bead beating for 7s (Minibeadbeater; Biospec) and then centrifuged 50xg for 10 min at 4°C to remove large plaques ...
-
No products found
because this supplier's products are not listed.
Pan Gong, et al.,
bioRxiv - Plant Biology 2021
Quote:
Confocal microscopy was performed using a Leica TCS SP8 point scanning confocal microscope (Figure 2, 3h upper panel, Supplementary figures 8, 9, 10a, and 10d) or Zeiss LSM980 confocal microscope (Carl Zeiss) (Figure 3e ...
-
No products found
because this supplier's products are not listed.
Samuel Itskanov, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 3 μM Fos-Choline-8 (Anatrace) was added to the protein sample ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Yumi Itoh, et al.,
bioRxiv - Microbiology 2023
Quote:
... Sf-9 cells (2 × 106) were seeded in 10-cm dishes (Greiner Bio-One GmbH, Frickenhausen, Germany) and were infected with recombinant AcNPV at a multiplicity of infection of 10 and incubated for 3 days ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Dan Luo, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... Obesity was induced in male C57BL/6N mice (age, 3-4 weeks; body weight, 11-13 g) by feeding on 60 kcal% HFD (Research Diets, Inc, New Brunswick, NJ, USA) for 12 weeks before the experiments ...
-
No products found
because this supplier's products are not listed.
Jiwoo Kim, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Gas tight 2 mL glass vials (AR0-37L0-13) and verex seals (AR0-5760-13) used to crimp vials were from Phenomenex.
-
No products found
because this supplier's products are not listed.
Robert Säbel, et al.,
bioRxiv - Plant Biology 2023
Quote:
... leaves number 8 and 13 were harvested and photos taken using a Zoom microscope (AZ100, Nikon). Trichome number was determined per leaf using ImageJ.
-
No products found
because this supplier's products are not listed.
P. Soblechero-Martín, et al.,
bioRxiv - Neuroscience 2021
Quote:
... aiming to skip DMD exon 51 (51-[T*C*A*A*G*G*A*A*G*A*T*G*G*C*A*T*T*T*C*T]-3⍰, Eurogentec, Belgium) by transfection with Lipofectamine as described in43,44 and analysed by either myoblot (96 well plates ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Swati Gupta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Western Blotting samples were denatured at 94°C for 5 minutes in 3 x SDS sample buffer (150mM Tris pH 8, 6% SDS, 0.3M DTT ...
-
No products found
because this supplier's products are not listed.
Narendra Mukherjee, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 7s between consecutive pulses = 1.1µL total volume injected per depth) controlled by a Nanoject III microinjector (Drummond Scientific). Following each unilateral set of injections ...
-
No products found
because this supplier's products are not listed.
Chenxin Li, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 10 ul M-Digestion Buffer and 1ml Proteinase K (Zymo D3001-2-5) were added and incubated for 20 minutes at 50°C ...
-
No products found
because this supplier's products are not listed.
Vanessa Simões, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Glutathione-containing beads (Goldbio G-250-5) were pre-washed with NETN buffer (3x ...
-
Salt precipitated protein. A lyophilized powder.
Cat# LS003324,
1 gm, $70.00
Ask
Luke R. Perreault, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Minced tissue underwent 3-5 serial digestions in collagenase type 2 (Worthington Biochemical Corp, Lakewood, NJ) in sterile PBS with 20 mM glucose ...
-
No products found
because this supplier's products are not listed.
Astrid De Roover, et al.,
bioRxiv - Cell Biology 2021
Quote:
... for 6h and measuring the absorbance at 595 nm with a spectrophotometer (BioTek Synergy).
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Sara Marelli, et al.,
bioRxiv - Microbiology 2019
Quote:
... washed cell pellets were lysed in 50 mM HEPES pH 8 with 5% SDS followed by 10 min (30 sec on/off) sonication in a Bioruptor Pico sonicator (Diagenode) at 18 °C ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 7: 3-methyl-L-histidine (NmH2, Chem-Impex International); 8 ...
-
No products found
because this supplier's products are not listed.
Jingjing Zang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 mice at each time point (ZT 1, 5, 9, 13, 17, 21) were sacrificed and RNA was extracted (Macherey-Nagel, Oensingen, Switzerland) according to manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Katharine Umphred-Wilson, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... incubated with 7-AAD (Tonbo Bioscience #13-6993-T500) for 20 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2022
Quote:
... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
No products found
because this supplier's products are not listed.
Eline Berends, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 7 and 13 using the tail- cuff plethysmography (CODA, Kent Scientific) as previously described (Foulquier et al. ...
-
No products found
because this supplier's products are not listed.
Bryan Gutierrez, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Tris(3-hydroxypropyltriazolyl-methyl)amine (THPTA) was purchased from Click Chemistry Tools. 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) ...
-
No products found
because this supplier's products are not listed.
Lavisha Parab, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 5 mL supplemented LB in a 13 mL culture tube (Sarstedt) was inoculated with a single isolated colony from a quadrant-streaked plate and incubated for 17 hours at 37°C with shaking at 250 rpm (New Brunswick™ Innova® 44 ...
-
No products found
because this supplier's products are not listed.
Ana Lucia Rosales Rosas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
7-Deaza-2’-C-Methyladenosine (7-DMA) was purchased from Carbosynth (Berkshire, UK) and dissolved in DMSO ...
-
No products found
because this supplier's products are not listed.
Haixiao Fan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... cells were incubated with 3 μL of 10 mM Fluo-8 AM solution (21082, AAT Bioquest, US), 1.2 μL of 10% (w/v) ...
-
No products found
because this supplier's products are not listed.
Dennis Das Gupta, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-IL-7 (BioXCell, 10 µg/ml), rmIL-7 or respective combinations ...
-
No products found
because this supplier's products are not listed.
Kazuma Katano, Takao Oi, Nobuhiro Suzuki,
bioRxiv - Plant Biology 2019
Quote:
... or subjected to heat stress for 5-9 or 10-14 days as described above using a stereoscopic light microscope (SZX12, Olympus、Japan) and a scanning electron microscope (SEM ...
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...