-
No products found
because this supplier's products are not listed.
Natasha D. Durham, et al.,
bioRxiv - Microbiology 2019
Quote:
... developed for 20 min with 50 µl/well SciColor T12 (Cat# CD-5600-100; Scienion AG), then analyzed using sciREADER CL2 (Scienion AG) ...
-
No products found
because this supplier's products are not listed.
Adrienne R. Guarnieri, et al.,
bioRxiv - Physiology 2021
Quote:
... IL-6 (Bioss BSKM1004) and TNF-α (Bioss BSKM1002 ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Zachary C. Holmes, et al.,
bioRxiv - Microbiology 2021
Quote:
... their urine was subjected to a pregnancy test (Quidel QuickView One-Step hCG Urine Test) to minimize the risk that prebiotic treatment would impact newborn or infant health ...
-
No products found
because this supplier's products are not listed.
Maja Gehre, et al.,
bioRxiv - Genetics 2019
Quote:
... Lysis buffer was prepared by diluting one part direct-lysis reagent (301-C, Viagen Biotech) in two parts destilled water (e.g ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Ward Vleeshouwers, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were plated one day prior to measurements or transfection in Willco dishes (Willco Wells BV) at 400.000 cells/dish or in 96 well-plate (microplate BD Falcon ...
-
No products found
because this supplier's products are not listed.
Emma G. Bouck, et al.,
bioRxiv - Pathology 2020
Quote:
... Cadherin-6 expression was quantified using Quantum Simply Cellular beads (Bangs Laboratories, Inc) to generate a standard curve of antibody binding sites as previously described.[10–12]
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Cheng Zhang, et al.,
bioRxiv - Systems Biology 2022
Quote:
... and the Pklr KO mice as well as the wild-type ones are purchased from Applied StemCell company ...
-
No products found
because this supplier's products are not listed.
Nai-Wen Chi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Similar staining patterns were observed (not shown) using two additional rabbit polyclonal GCK antibodies: one from Genetex Inc ...
-
No products found
because this supplier's products are not listed.
Marina Barba-Aliaga, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and mixed with one volume of glass beads for further homogenization in a Precellys tissue homogenizer (Bertin Corp.). Lysates were cleared by centrifugation at 12000 rpm for 5 min at 4°C and protein extracts were assayed for firefly and Renilla luciferase activity sequentially in a 96-well luminometry plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Satish K. Tadi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples were then loaded into custom-made C18 StageTips packed by stacking one AttractSPE® disk (#SPE-Disks-Bio-C18-100.47.20 Affinisep) and 2mg beads (#186004521 SepPak C18 Cartridge Waters ...
-
No products found
because this supplier's products are not listed.
Orsolya Németh-Szatmári, et al.,
bioRxiv - Molecular Biology 2022
Quote:
6 × 105 cells/flask were seeded into T25 cell culture flasks (Biologix, Jinan, Shandong, China) and left to grow for 24 h ...
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Dimitrios Papagiannidis, et al.,
bioRxiv - Cell Biology 2021
Quote:
... One-hundred microliters of each sample was transferred into 96 well glass bottomed microtiter plates (Brooks Life Sciences, Chelmsford, Massachusetts) coated with concanavalin A and allowed to attach ...
-
No products found
because this supplier's products are not listed.
Dmitry Y. Panteleev, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... pre-washed cells were lysed in x1 Laemmli buffer and analyzed with one-dimensional PAGE followed by western blotting using Anti-TurboGFP(d) antibodies (Evrogen, Russia).
-
No products found
because this supplier's products are not listed.
Jia Gu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The cells were exposed to 6 Gy radiation from the X-ray tube (Rad Source Technologies, USA) at a fixed dose rate of 1.15 Gy/min.
-
No products found
because this supplier's products are not listed.
Emma Laporte, et al.,
bioRxiv - Developmental Biology 2022
Quote:
WT (C57BL/6) neonatal mice (PD5) were treated twice with 5 μg LGK-974 (Biogems, Westlake Village, CA) per g bodyweight or vehicle (corn oil ...
-
No products found
because this supplier's products are not listed.
D. Brent Halling, et al.,
bioRxiv - Biophysics 2022
Quote:
... Ca2+ chelators were used in the intracellular solution to control free Ca2+ and (+)-(Crown-6)-2,3,11,12-tetracarboxylic acid (Synquest Laboratories) was used to chelate any contaminating barium to prevent barium block of channels ...
-
No products found
because this supplier's products are not listed.
Catarina J. Gaspar, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were transfected with fluorescent reporter constructs (1 μg total DNA/well, 6 well plate) using GenJet (SignaGen Laboratories) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Biliana Marcheva, et al.,
bioRxiv - Cell Biology 2021
Quote:
... RNA was extracted from Beta-TC-6 cells and pseudoislets using Tri Reagent (Molecular Research Center, Inc, Cincinnati, OH) and frozen at ™80°C ...
-
No products found
because this supplier's products are not listed.
Aki Teranishi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... the mechanosensitive cation channel inhibitor (e.g., Piezo1, TRPC1/6) GsMTx4 (Abcam or Peptide Institute, 2.5 μM, 15-min incubation)l the intracellular calcium chelator BAPTA-AM (Tronto Research Chemicals ...
-
No products found
because this supplier's products are not listed.
Marco Todesco, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Seeds were then rinsed twice in distilled water and treated for at least one hour in a solution of 1% PPM (Plant Cell Technologies, Washington, DC, USA), a broad-spectrum biocide/fungicide ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Sofia Nasif, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2×105 cells per well were seeded into a 6-well plate and transfections were performed using the Lullaby transfection reagent (OZ Biosciences). Transfection complexes were prepared in Opti-MEM™ (Gibco ...
-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
P. Diep, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Common cation elements (Al, K, Pb, Mn, Cd, Fe, Mg, Na, Co, Zn, Cu, Cr, Ca, and Ni) (Inorganic Ventures, #IV-28) and suspected anion elements (S ...
-
No products found
because this supplier's products are not listed.
Jiling Feng, Yuexun Tang, Wenwei Fu, Hongxi Xu,
bioRxiv - Cell Biology 2023
Quote:
... RT-PCR was performed with a one-step real time PCR using KAPA SYBR FAST One-Step qRT-PCR Universal (D-MARK Biosciences). Primers were used as previously described [18] ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Yakun Liu, et al.,
bioRxiv - Pathology 2020
Quote:
... We also used archived normal NHP tissue lung sections (from one rhesus macaque and one cynomolgus macaque) purchased from Zyagen (San Diego, CA) as controls.
-
No products found
because this supplier's products are not listed.
Yuichiro Honda, et al.,
bioRxiv - Pathology 2020
Quote:
... The sections were blocked with 5% bovine serum albumin in PBS for 60 min and incubated overnight at 4°C with a mouse anti-CD-11b primary antibody (1:2000; BMA Biomedicals, Augst, Switzerland) or a rabbit polyclonal anti-dystrophin primary antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Yedan Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... One fiber-optic probe (91-00124, Perimed Inc., Las Vegas, NV) coupled with a laser-Doppler flowmeter (LDF ...
-
No products found
because this supplier's products are not listed.
Snježana Kodba, et al.,
bioRxiv - Cell Biology 2024
Quote:
... one well of an 8-well Ibidi chambers (IBI Scientific #80807) was coated with 10 mg/mL Laminin (Sigma ...
-
No products found
because this supplier's products are not listed.
Sylwia Machcinska, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Inc.)-conjugated cytokeratin 6 (CK6; NSJ Bioreagents, Cat # V2168) antibodies ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Haley N. Bridge, Clara L. Frazier, Amy M. Weeks,
bioRxiv - Biochemistry 2023
Quote:
... Azide-SS-biotin (6) was purchased from Broadpharm. Biotin-Diazo-azide (9) ...
-
No products found
because this supplier's products are not listed.
Murat Artan, et al.,
bioRxiv - Biochemistry 2022
Quote:
One ml of PureCube Ni-NTA agarose resin slurry (Cube Biotech, Germany) was transferred to a 15 ml Falcon tube ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... EPA 200.7 standard 6 purchased from High-Purity Standards was used for calibration ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Kärt Mätlik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cerebella were soaked in the DNA for 15-20 minutes on ice and were transferred one at a time into the well of an electroporation chamber (Protech International Inc ...
-
Cat# 3074-00-8,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rats received one intraperitoneal injection of 5-Ethynyl-2’-deoxyuridine (EdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 61135-33-9) and were killed 6 (CTL n = 8 ...
-
No products found
because this supplier's products are not listed.
Steven D. De Michino, et al.,
bioRxiv - Genomics 2023
Quote:
... a predetermined quantity (10-300 ng SU-DHL-6 cfDNA) was diluted in RPMI 1640 (Wisent Bioproducts, CAT #350-000-CL) and subjected to ChIP-Seq adapted from Sadeh et al21 ...