-
No products found
because this supplier's products are not listed.
Teng-Chieh Yang,
bioRxiv - Bioengineering 2023
Quote:
... One (1) μm yellow PSP and 6 μm red PSP were from Polyscience Inc ...
-
No products found
because this supplier's products are not listed.
Alexandra Chrysanthou, et al.,
bioRxiv - Bioengineering 2022
Quote:
Mesenchymal stem cells (P3-6, Promocell) were cultured in mesenchymal stem cell growth medium 2 (PromoCell) ...
-
No products found
because this supplier's products are not listed.
Ida Paciello, et al.,
bioRxiv - Immunology 2024
Quote:
... 6% of baby rabbit complement (Cedarlane) diluted in Expi medium was added ...
-
No products found
because this supplier's products are not listed.
Maria del Mar Aguilo-Ferretjans, et al.,
bioRxiv - Microbiology 2020
Quote:
... one-way stopcock valves (WZ-30600-00; Cole-Parmer, USA), and Luer connectors ...
-
No products found
because this supplier's products are not listed.
Kanve N. Suvilesh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK5/6 (mouse, ACR 105, 1:100; Biocare Medical), thyroid transcription factor (TTF-1 ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Claire Scott, et al.,
bioRxiv - Microbiology 2019
Quote:
Peptides (Eng195 M2-N31 CD and TM, M2-S31 CD) were purchased from Peptides International, and supplied lyophilised as a TFA salt ...
-
No products found
because this supplier's products are not listed.
Hamid Keshmiri, et al.,
bioRxiv - Biophysics 2023
Quote:
... U2OS cells were treated with 10 µM trichostatin A (TSA) for 6h (AbMole M1753), 25 µM camptothecin for 1h (Sigma-Aldrich C9911) ...
-
No products found
because this supplier's products are not listed.
Uxia Gurriaran-Rodriguez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... After 6h of transfection cells were treated overnight with PORCN inhbibitor diluted in DMSO (AdooQ) at two different concentrations 100nM and 500nM in fresh media ...
-
No products found
because this supplier's products are not listed.
Bin Qiu, et al.,
bioRxiv - Physiology 2023
Quote:
... followed by either CS or CD medium (#DFL25-500ML, Caisson Labs) for 4 hours or 24 hours ...
-
No products found
because this supplier's products are not listed.
Hari-Hara SK Potula, et al.,
bioRxiv - Microbiology 2019
Quote:
... CD44 and B cells was CD-19 conjugated with PercP Cy5.5 (Tonbo Biosciences) were described previously57 ...
-
No products found
because this supplier's products are not listed.
Xuan Yang, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Mouse cryopreserved hepatocytes were supplied by BioIVT (lot ZPG, pooled male CD-1). Vials of cryopreserved hepatocytes were removed from storage and thawed in a 37°C water bath with gently shaking ...
-
No products found
because this supplier's products are not listed.
Rachel Bezalel-Buch, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 39mer 8 atom 6 bp ICL (39+6 DMEDA ICL) were synthesized and purified as previously reported (33) ...
-
No products found
because this supplier's products are not listed.
Ami Vadgama, et al.,
bioRxiv - Immunology 2023
Quote:
... 0.3-30μM thrombin-receptor activating peptide 6 (TRAP-6; Cambridge Biosciences); 0.3-30μM U46619 (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Raphael A. Reyes, et al.,
bioRxiv - Immunology 2024
Quote:
... One hundred fifty µL blocking buffer (one-third Non-Animal Protein (NAP)-Blocker (G-Biosciences #786-190P) and two-thirds PBS ...
-
No products found
because this supplier's products are not listed.
Joseph M. Varberg, et al.,
bioRxiv - Cell Biology 2020
Quote:
... pombe cDNA library (AS One International, Inc.) using KOD Hot Start DNA polymerase (Millipore Sigma) ...
-
No products found
because this supplier's products are not listed.
Viktoriya Zhuravleva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-Syntaxin-6 (Synaptic Systems) + Alexa Fluor-647 to tag the trans-Golgi network (TGN) ...
-
No products found
because this supplier's products are not listed.
Yuka Sakata, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antigens were retrieved using HistoVT One (Nacalai USA) for 20 min at 70 °C and washed in PBS for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Félix Velando, et al.,
bioRxiv - Microbiology 2024
Quote:
... One-microliter capillary tubes (P1424, Microcaps; Drummond Scientific) were heat-sealed at one end and filled with either the chemotaxis buffer (negative control ...
-
No products found
because this supplier's products are not listed.
Maxime Mivelaz, et al.,
bioRxiv - Biophysics 2019
Quote:
... Flow-chambers were assembled from one glass slide and one coverslip separated by double-sided 0.12 mm tape (Grace Bio-labs) positioned between each hole in the glass slide ...
-
No products found
because this supplier's products are not listed.
I. Fayer, et al.,
bioRxiv - Biophysics 2020
Quote:
... 6 μM Biotin tubulin (T333P, Cytoskeleton), 3 μM Rhodamine tubulin (TL590M ...
-
No products found
because this supplier's products are not listed.
Rui Sun, et al.,
bioRxiv - Systems Biology 2022
Quote:
... and everolimus (Targetmol, 159351-69-6). The cells were then incubated for 72 hrs ...
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-6 (Lot: 449268JEI6, Elabscience, China), and IL-10 (Lot ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
One or two liters of Trichoplusia (Tni) cells (Expression System) were infected with recombinant baculoviruses at a cell density of 1.5-2.0 × 106 cells per mL ...
-
No products found
because this supplier's products are not listed.
Tristan Lerbs, et al.,
bioRxiv - Immunology 2020
Quote:
We used a One Step Trichrome Stain Kit (American MasterTech). After deparaffinization and rehydration ...
-
No products found
because this supplier's products are not listed.
Mariya B Shapiro, et al.,
bioRxiv - Immunology 2023
Quote:
One alpaca was immunized with PSMA-His protein (Sino Biological) and CFA/IFA adjuvant administered every 21 days over the study period ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Azlann Arnett, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6 μl 5M NaCL (Active Motif) for 30 minutes at 37°C followed by 2 μl proteinase K (Active Motif ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Simona Notova, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 45% precipitant mix 6 Morpheus II (Molecular Dimensions) for SeMet protein ...
-
No products found
because this supplier's products are not listed.
Maximilian Lenz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and TTX (0.5 μM; Biotrend #18660-81-6) were added to the external solution ...
-
No products found
because this supplier's products are not listed.
N Bhaskaran, et al.,
bioRxiv - Immunology 2021
Quote:
... and IL-6 ELISA kits were from Boster Bio (Pleasanton ...
-
No products found
because this supplier's products are not listed.
Martin Thunemann, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A tungsten extracellular microelectrode (FHC, 6-8 MΩ) was used to determine the location of the C1 whisker representation on the whisker-barrel cortex prior to electrode array placement ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Yicheng Wang, et al.,
bioRxiv - Biochemistry 2021
Quote:
... UDP-[6-3H]GlcNAc (ART 1136, American Radiolabeled Chemicals), phosphatidylinositol ...
-
No products found
because this supplier's products are not listed.
Sarah M. Glenn, et al.,
bioRxiv - Microbiology 2023
Quote:
... C57BL/6 wild type and iNOS knockout mutant (Kerafast) cell lines were grown at 37°C with 5% CO2 in Dulbecco’s Modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laura L Gathercole, et al.,
bioRxiv - Physiology 2021
Quote:
... 7α,12α-dihydroxycholest-4-en-3-one-d7) (Toronto Research Chemicals, Ontario, Canada) and homogenized in chloroform/methanol (4 ml ...
-
No products found
because this supplier's products are not listed.
Xiaodong Duan, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Each drive was loaded with closely aligned one optical fiber (230 um, RWD Life Science) and 4 tetrodes ...
-
No products found
because this supplier's products are not listed.
Fyodor D. Urnov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... one-fifth of each sample was then electrophoresed on a 2% high-resolution blend agarose (Amresco) gel in 1x Tris-acetate-EDTA buffer (40 mM Tris-acetate ...
-
No products found
because this supplier's products are not listed.
Ningning Zhang, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Each sample was aliquoted and one of them was added with ascorbate (Thomas Scientific LLC, C988F55) to a final concentration of 100 mM ...
-
No products found
because this supplier's products are not listed.
Terry R. Suk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... cDNA was synthesized using 5X All-in-One RT Master Mix (Bio Basic cat# HRT025-10) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Thomas Kehrer, et al.,
bioRxiv - Microbiology 2022
Quote:
... cells were resuspended in one volume buffer A (15 mM Tris-HCl pH 8 (Boston Bioproducts), 15 mM NaCl (Corning) ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Shijie Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
Di-docosahexaenoyl (22:6) bis (monoacylglycerol) phosphate (di-22:6-BMP) was measured in plasma and exosome-depleted urine and CSF by ultra-performance liquid chromatography – tandem mass spectrometry (UPLC-MS/MS) ...
-
No products found
because this supplier's products are not listed.
Matthew G. Blango, et al.,
bioRxiv - Microbiology 2021
Quote:
... One scoop of 0.15 mm zirconium oxide beads (Next Advance; ZrOB015) was added to each tube and bacteria were lysed using a Bullet Blender (Next Advance ...
-
No products found
because this supplier's products are not listed.
H Brünner, et al.,
bioRxiv - Neuroscience 2023
Quote:
... One Teflon coated stainless steel wire (0.005 inch bare, A-M systems) from the electrode interface board (EIB ...
-
No products found
because this supplier's products are not listed.
Koji Ohira, et al.,
bioRxiv - Neuroscience 2019
Quote:
... One group was treated with FLX pellets (Innovative Research of America, Sarasota, FL) for 4 weeks at a dose of 3 mg/kg/day ...