-
No products found
because this supplier's products are not listed.
D Muñoz-Reyes, et al.,
bioRxiv - Biochemistry 2022
Quote:
... NCS-1ΔH10/Ric-8A-P2 peptide and NCS-1ΔH10/Ric-8A-P3 peptide were performed using a Tycho NT.6 instrument (NanoTemper Technologies). Proteins at 10 μM in their corresponding final buffers (see above ...
-
No products found
because this supplier's products are not listed.
Yajie Wang, et al.,
bioRxiv - Plant Biology 2022
Quote:
... total RNAs isolated from the leaves of SC8 and mutant lines (#1, #2, #3, #4) using RNAplant Plus reagent (TianGen, Beijing, China) following the manufacturer’s instructions were reversed by using the reverse transcriptase kit (TaKaRa ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Miriam Pagin, et al.,
bioRxiv - Genetics 2021
Quote:
... wild-type and Sox2-deleted neurospheres were grown for 2-3 passages (3-4 days each) in FM supplemented with bFGF (10ng/ml, Tebu-bio) and EGF (10 ng/ml ...
-
WB, IHC,ELISA
Cat# A5233, SKU# A5233-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Daniela Saderi, Brad N. Buran, Stephen V. David,
bioRxiv - Neuroscience 2019
Quote:
... 1 to 4 high-impedance tungsten microelectrodes (FHC or A-M Systems, impedance 1-5 MΩ) were slowly advanced into cortex with independent motorized microdrives (Alpha-Omega) ...
-
No products found
because this supplier's products are not listed.
Leon Zhen Wei Tan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Wild-type PAO1 were fed with ABTG containing either freshly prepared 2 µM auranofin or DMSO (as solvent control) at the rate of 4 ml h-1 via peristaltic pump (Cole-Parmer®) in 37 °C condition ...
-
No products found
because this supplier's products are not listed.
Koen J.A. Martens, et al.,
bioRxiv - Biophysics 2020
Quote:
... was then guided into a 4f geometry using the following lenses (1: f = 200mm, 2: f = 100mm, 3: f = 100mm) towards a Prime 95B sCMOS camera (Photometrics, Tucson, AZ, USA), resulting in an effective 115 by 115 nm pixel size ...
-
No products found
because this supplier's products are not listed.
Gabriela F. Paredes, et al.,
bioRxiv - Microbiology 2021
Quote:
... and single worms of similar size (1-2 mm length, representing adult L. oneistus) were handpicked by forceps (Dumont 3, Fine Science Tools, Canada) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Angélica Díaz-Basabe, et al.,
bioRxiv - Immunology 2023
Quote:
... STAT-3 (1:600, E-Ab-40131, Elabscience, Houston, Texas, USA); GSK-3ab (1:500 ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Ahmed S Abdelfattah, et al.,
bioRxiv - Neuroscience 2021
Quote:
... at ~1×105 cells per well in 100 μL of a 4:1 mixture of NbActiv4 (BrainBits) and plating medium (28 mM glucose ...
-
No products found
because this supplier's products are not listed.
Phuong T. Lam, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Corning)-coated dishes in NIM at an approximate density of 20 aggregates per cm2 and switched to DMEM/F12 (3:1) supplemented with 2% Gem21 NeuroPlex (without vitamin A, Gemini Bio-Products, 400-161), 1X NEAA ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
K Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Overnight primary antibody incubation at 4°C was completed for the following targets: PDE11A (Aves custom PDE11#1 at 1:10,000; Fabgennix PD11A-112 at 1:500), CREB (Cell Signaling #4820 at 1:10,000 ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Jenna Treissman, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 4 °C: Anti-HLA-G (1:100, 4H84, Exbio, Vestec, Czech Republic); anti-cytokeratin 7 ...
-
No products found
because this supplier's products are not listed.
P. Lejeune, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Jiffypots® with weak or abnormal plantlets were discarded and the others were transplanted into 12-cm square plastic cultivation pots filled with 1.5 L of leaf mould and baked clay (4:1) mixed with 6 gr.L−1 of slow release fertilizer (Osmocote Exact Standard 5-6 M, ICL Specialty Fertilizers). The pots were fitted at the bottom with a 2 x 10 cm felt wick and randomly placed on the deck of the cultivation gutters described above ...
-
No products found
because this supplier's products are not listed.
John C. Ahn, Scott M. Coyle,
bioRxiv - Systems Biology 2023
Quote:
... 0.1 mg ml-1 PLL(20)-g[3.5]-PEG(2) (SuSoS CHF9,600.00) solution was added for 1 hour ...
-
No products found
because this supplier's products are not listed.
Ching-Lin Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... with a 4:1 ratio of O2/H2 and stained using methylamine tungstate (Nanoprobes). Grids were imaged at a magnification of 92,000X (corresponding to a calibrated pixel size of 1.63 Å/pix ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Sai Li, et al.,
bioRxiv - Biophysics 2022
Quote:
... Laminar-flow-separated channels 1-3 were used to form DNA tethers between two 4.35-μm streptavidin-coated polystyrene beads (Spherotech). Channels 4 and 5 served as protein loading and imaging channels ...
-
No products found
because this supplier's products are not listed.
Sachiko Koyama, et al.,
bioRxiv - Physiology 2019
Quote:
... and went through overnight staining at 4°C with anti-BrdU (1:300, rat, Accurate Chemical Co. #OBT0030). On the second day ...
-
No products found
because this supplier's products are not listed.
Esther Dawen Yu, et al.,
bioRxiv - Immunology 2022
Quote:
... 1:1 Non Animal Protein-BLOCKER™ (G-Biosciences) in TBS was added for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Maxence LANOIZELET, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... (1) 2 hrs at RT or O/N at 4°C in 75 µg/ml of CBM3a-GFP (CZ00571, Nzytech), (2 ...
-
No products found
because this supplier's products are not listed.
Christine Chevalier, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Immunostaining was performed overnight at +4°C with primary antibodies (H3K4me2 1:1000; Abcam ab32356) (H3K4me3 1:200; Diagenode C15410003) (H3K4me2 1:1000; EpiGentek A4032) (LAMP1 1:1000 ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, Ekaterina E. Heldwein,
bioRxiv - Microbiology 2021
Quote:
... a total of 10 μL of GUVs with a 3:1:1 molar ratio of POPC:POPS:POPA containing ATTO-594 DOPE (ATTO-TEC GmbH) at a concentration of 0.2 μg/μL was mixed with 1 μM NEC220 (final concentration) ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Kathrin Leppek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
No products found
because this supplier's products are not listed.
Daniel Ten Martin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... blocked in 3% BSA/ 5% normal goat serum in PBS for 1h and incubated overnight at 4°C with primary antibodies (β-III tubulin/anti-tuj-1, 1/1000, Biolegend n°801202; anti-GFP, 1/1000, Torrey Pines Biolabs n°TP-401) diluted in the blocking solution ...
-
No products found
because this supplier's products are not listed.
Hong Zheng, et al.,
bioRxiv - Microbiology 2021
Quote:
... the cells were labeled with 1:500 rabbit anti-CSP overnight at 4°C and 1:100 Red donkey anti-rabbit secondary antibody (Abbkine) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Elizabeth J Glover, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Permeabilization was enhanced by incubation in 0.4% Triton-X in PBS followed by incubation in primary antibodies in PBS containing 0.2% Triton-X overnight at 4 °C (CtB 1°: 1:500, List Biological Laboratories #703 ...
-
No products found
because this supplier's products are not listed.
Alexis Casciato, et al.,
bioRxiv - Physiology 2022
Quote:
... concomitantly with DAPI at 1:1000 (Immunochemistry technologies, 2 hours, room temperature). They were then washed ...
-
No products found
because this supplier's products are not listed.
Trevor M Nolan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... plated on 1/2 Linsmaier and Skoog (LSP03-1LT, Caisson Labs; pH 5.7), 1% sucrose media ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Claudia Z. Han, et al.,
bioRxiv - Genomics 2021
Quote:
... 1 mM EDTA)) for mechanical dissociation using a 2 ml polytetrafluoroethylene pestle (Wheaton, 358026)1 ...
-
No products found
because this supplier's products are not listed.
Adriana C. Rodriguez, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and incubated overnight at 4°C in primary antibodies: ETV4 (Aviva ARP 32263_P050; 1:500 dilution), ERα (Santa Cruz HC-20 ...
-
No products found
because this supplier's products are not listed.
Subbaiah Chalivendra, et al.,
bioRxiv - Plant Biology 2020
Quote:
... of the seed meal were extracted with 25 mL 1:1 acetonitrile/water for 2 h on a Model G2 Gyrotory Shaker (New Brunswick Scientific, Edison, NJ, USA). Extracts were filtered with a Whatman 125 mm 2V paper filter (GE Healthcare Bio-Sciences ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... serum was diluted 1/200 and then applied to HEp-2 slides (Antibodies Incorporated or BD). Staining was detected using goat anti-mouse IgG FITC at 1:500 (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
James R. Occean, et al.,
bioRxiv - Genomics 2023
Quote:
... The sections were blocked for 1 h at room temperature with 2% normal goat serum (Vector Biolabs) then incubated with 2 µg/mL dilution 5hmC antibody (Active Motif ...