-
No products found
because this supplier's products are not listed.
Vernon Garcia-Rivas, et al.,
bioRxiv - Neuroscience 2021
Quote:
Varenicline or 7,8,9,10-Tetrahydro-6,10-methano-6H-pyrazino[2,3-h] [3]benzazepine tartrate (Tocris, UK) was dissolved in sterile 0.9% physiological saline for a final dose of 1 mg/kg free base ...
-
No products found
because this supplier's products are not listed.
Connor Rogerson, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 1 μM SCR7 pyrazine (Sigma-Aldrich, SML1546), to promote homologous recombination and to inhibit non-homologous end joining respectively ...
-
No products found
because this supplier's products are not listed.
Ludovica Iovino, et al.,
bioRxiv - Neuroscience 2022
Quote:
... were incubated for 10 min at 37 °C in the presence of 10 µM 2-amino-5,6,7,8-tetrahydro-4-(4-methoxyphenyl)-7-(naphthalen-1-yl)-5-oxo-4H-chromene-3-carbonitrile (UCPH-101; Abcam 120309, UK), a specific excitatory amino acid transporter 1 (EAAT1/Glast ...
-
No products found
because this supplier's products are not listed.
Sander Barnhoorn, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Goat Anti-Rabbit Alexa Fluor 488 (1:500, Invitrogen, A11008#8a), Donkey Anti-Goat Alexa Fluor 488 (1:500 ...
-
No products found
because this supplier's products are not listed.
Josette Medicielo, et al.,
bioRxiv - Genomics 2023
Quote:
... and Tetrahydro-2-furoic acid (SC-253674) were obtained from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Sheree D. Martin, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
No products found
because this supplier's products are not listed.
Saori Shinoda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 1,2-dioleoyl-sn-glycero-3-phospho-(1′-myo-inositol-3′,4′-bisphosphate) (18:1 PI(3,4)P2) (850153P; Avanti Polar Lipids) dissolved in chloroform to 1 µM final concentrations were mixed in a glass tube at the indicated ratios in the figure legends ...
-
No products found
because this supplier's products are not listed.
Meaghan H. Hancock, et al.,
bioRxiv - Microbiology 2020
Quote:
... Flt-3R (8F2, Cell Signaling), FOXO3a (Cell Signaling) ...
-
No products found
because this supplier's products are not listed.
Irene Julca, et al.,
bioRxiv - Plant Biology 2022
Quote:
... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
No products found
because this supplier's products are not listed.
Claudia Matthaeus, et al.,
bioRxiv - Cell Biology 2022
Quote:
anti-Dynamin 1/2/3-mouse (BD Science, 1:1000), anti-Pacsin2-Rabbit (Proteintech ...
-
No products found
because this supplier's products are not listed.
Esteban Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
No products found
because this supplier's products are not listed.
D Muñoz-Reyes, et al.,
bioRxiv - Biochemistry 2022
Quote:
Purified rRic-8A-452 and NCS-1ΔH10/rRic-8A-452 were phosphorylated with casein kinase II (CK2, New England Biolabs) as previously described by McClelland et al ...
-
No products found
because this supplier's products are not listed.
Smita S. Chandran, et al.,
bioRxiv - Immunology 2021
Quote:
... Candidate TCR-transduced T cells were then added in at an E:T ratio of 1:1 for 6h in the presence of anti-CD107A-BV650 (Clone H4A3, Biolegend 328638) and Golgi Block ...
-
No products found
because this supplier's products are not listed.
Roza Izgilov, et al.,
bioRxiv - Cell Biology 2023
Quote:
using a fluorescent glucose analog, 2-NBDG (2-Deoxy-2-[(7-nitro-2, 1, 3-benzoxadiazol-4-yl) amino]-D-glucose) (11046, Cayman chemical). Cultured 3T3-L1 cells “starved” in a glucose-free medium at 37°C for 1 hr ...
-
No products found
because this supplier's products are not listed.
Wyatt E. Lanik, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Corning) supplemented with 10% heat inactivated fetal bovine serum (Sigma) ...
-
No products found
because this supplier's products are not listed.
Qianqian Gao, et al.,
bioRxiv - Genetics 2019
Quote:
... at a weight ratio of 4:3:2 using 54 µL PEI (Polysciences, 24765-1, 1 µg/µl). We changed the medium after 4-6 hours of incubation at 37 °C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Cells were incubated in PBS with 3% donkey serum and the following primary antibodies overnight at 4 °C: rabbit anti-Perilipin 2 (1:200; Proteintech 15294-1-AP), rabbit anti-ACSL1 (1:100 ...
-
No products found
because this supplier's products are not listed.
M. Eugenia Dieterle, et al.,
bioRxiv - Microbiology 2020
Quote:
... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
No products found
because this supplier's products are not listed.
Enrico Capobianco, et al.,
bioRxiv - Cancer Biology 2023
Quote:
NMDI-14 inhibitor (Ethyl 2-(((6,7-dimethyl-3-oxo-1,2,3,4-tetrahydro-2-quinoxalinyl)acetyl)amino)-4,5-dimethyl-3-thiophenecarboxylate) was purchased from Calbiochem (Cat. Nr. 530838) and reconstituted in DMSO (10mg/ml ...
-
No products found
because this supplier's products are not listed.
Brian T. Do, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
No products found
because this supplier's products are not listed.
James Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 3-([3-cholamidopropyl]dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, Anatrace) was added to the sample (8 mM final) ...
-
No products found
because this supplier's products are not listed.
Apurva A. Govande, et al.,
bioRxiv - Microbiology 2023
Quote:
... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
No products found
because this supplier's products are not listed.
Michael Chabot, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (VWR, Radnor, PA), NaCl (VWR) ...
-
No products found
because this supplier's products are not listed.
Joshua Mills, et al.,
bioRxiv - Microbiology 2023
Quote:
... with a final concentration of 2% formaldehyde and 2% NuSieve 3:1 agarose (Lonza). 5 µg RNA was denatured for 10 min at 70 °C with 1 X MOPS buffer (20 mM MOPS ...
-
No products found
because this supplier's products are not listed.
Martineau Éric, et al.,
bioRxiv - Neuroscience 2020
Quote:
... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
No products found
because this supplier's products are not listed.
Els F Halff, et al.,
bioRxiv - Neuroscience 2020
Quote:
... followed by overnight incubation at 4°C with primary antibody diluted in blocking solution (1:1000 Rabbit-α-SV2A, Abcam ab32942, Cambridge, UK; 1:300 Mouse-α-Neuroligin1/2/3/4, Synaptic Systems 129211, Göttingen, Germany). Sections were then washed in PBS (3×10 min ...
-
No products found
because this supplier's products are not listed.
B. Vanderperre, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fixed 1 min with 4% paraformaldehyde and stained with 2% uranyl acetate (EMS, 22400-2) for 1 min ...
-
No products found
because this supplier's products are not listed.
Theresa Pesch, et al.,
bioRxiv - Immunology 2019
Quote:
... rIL-4 (1 ng ml-1, Peprotech) was added to the primary culture for four days ...
-
No products found
because this supplier's products are not listed.
Y. Shi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 100ng/mL recombinant human fibroblast growth factor 8a (FGF-8a, R&D system) from day 2 to day 11 ...
-
No products found
because this supplier's products are not listed.
Debabrata Chowdhury, et al.,
bioRxiv - Immunology 2021
Quote:
... injection of 10 mg/kg poly(I:C) for 6h followed by 2 mg/kg ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
No products found
because this supplier's products are not listed.
Rekha S. Varrier, Emily S. Finn,
bioRxiv - Neuroscience 2022
Quote:
... animations were balanced within and between runs (run 1: 2M,3R; sequence M-R-R-M-R; run 2: 3M, 2R ...
-
No products found
because this supplier's products are not listed.
Biren M. Dave, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... differentiating cells were confluent again and split 1:3-1:4 into Step 2 differentiation medium: BrainPhys Neuronal Medium (STEMCELL Technologies, cat# 05790), 1X N2 ...
-
No products found
because this supplier's products are not listed.
Sarah Hyllekvist Jørgensen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and AKT 1/2/3 (p-S473) Assay Kits (PerkinElmer). Cell lysis and SureFire Assay were performed following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Marija Radosevic, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The slices were incubated for 3 - 4 hr at room temperature with Cyanine-3-conjugated (Cy3) to streptavidin (1:500 or 1:250 Jackson ImmunoResearch labs, Inc) in blocking buffer (PBS with 5% donkey serum and 0.3% Triton X-100) ...
-
No products found
because this supplier's products are not listed.
Sergio Lembo, et al.,
bioRxiv - Biophysics 2023
Quote:
... The blot was blocked in 5% BSA in TBST and subsequently incubated with primary antibody (anti-mDia1, #20624-1-AP, Thermo Fischer Scientific, 1:1000, overnight at 4° C; GAPDH, #NB300-221, Novus Biologicals, 1:40.000, 1-2 hrs at RT). Secondary antibody staining was performed for 1 hour at RT in blocking solution (Donkey-Anti-Rabbit-HRP ...
-
No products found
because this supplier's products are not listed.
Yaman Musdal, et al.,
bioRxiv - Biochemistry 2023
Quote:
The steroids 5-androsten-3,17-dione and 4-androsten-3,17-dione were purchased from Steraloids Inc ...
-
No products found
because this supplier's products are not listed.
Mariajose Metcalfe, et al.,
bioRxiv - Neuroscience 2023
Quote:
... FluoroMyelin green dye (1:30), and DAPI (4’, 6-diamidino-2-phenylindole dihydrochloride; 1:30) and cover-slipped with Vectashield mounting medium (Vector Laboratories) prior to examination.
-
No products found
because this supplier's products are not listed.
Amanda K. Riley, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 1 mg lysates were incubated with the appropriate agarose-conjugated primary antibody for 3-4 h at 4°C or with unconjugated antibody (1-2 mg) overnight at 4°C followed by 1 h incubation with Protein G Sepharose beads (GE Healthcare). Immuno-complexes were washed four times with NETN buffer (20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 1H, 1H, 2H, 2H-Perfluorohexane-1-ol (4:2-FTOH, CAS 2043-47-2, purity ≥ 97%) were from TCI America (Portland ...
-
No products found
because this supplier's products are not listed.
Amoldeep S. Kainth, Hesheng Zhang, David S. Gross,
bioRxiv - Genetics 2024
Quote:
... then 1-NM-PP1 (4-amino-1-tert-butyl-3-(1’-naphthylmethyl)pyrazolo[3-4-d]pyrimidine) (Toronto Research Chemicals, Inc.; no. A603003) was added to a final concentration of 15 μM ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Christophe Royer, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 3 to 4 week old CD-1 females (Charles River UK) were injected intraperitoneally with 5 IU of PMSG (Intervet ...
-
No products found
because this supplier's products are not listed.
Zhongyun Xie, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the lysate was made from 1∼2 ml packed worms with 3∼4 ml of 0.5-mm diameter glass beads using FastPrep-24 (MP Biomedicals) in lysis buffer [pH 7.4 ...
-
No products found
because this supplier's products are not listed.
He-Yun Hsiao, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
No products found
because this supplier's products are not listed.
Reena P. Murmu, et al.,
bioRxiv - Neuroscience 2019
Quote:
A glass micropipette (1–3 MΩ impedance; 2-μm tip; World Precision Instruments) was connected to a pneumatic injector (3–20 PSI ...
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Tommaso Zeppillo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM 6-cyano-7-nitroquinoxaline-2,3-dione (NBQX, Hello Bio, Bristol, UK) and 2 μM (R)-3-(2-Carboxypiperazin-4-yl)-propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Mingyue Li, et al.,
bioRxiv - Microbiology 2021
Quote:
... 10 μg·ml-1 anti-IL-4 and 10 μg·ml-1 anti-IL-2 (Bio X Cell, Cat# BE0043-1, RRID:AB_1107705). For Treg cell differentiation ...
-
Salt precipitated protein. A lyophilized powder.
Cat# LS003324,
1 gm, $70.00
Ask
Kwangdeok Shin, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... Zebrafish ventricles were fixed in 3% PFA for 5 min and incubated in PBS supplemented with 1 mg/mL collagenase type 4 (Worthington Biochemical) at 4°C overnight ...