-
No products found
because this supplier's products are not listed.
Kyla D Omilusik, et al.,
bioRxiv - Immunology 2021
Quote:
... Id3 (1:1000; 6-1, CalBioreagents), Usp1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Matthew D. Kerr, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-bicyclo[2.2.1]hept-5-en-2-ylmethanamine (norbornene amine) was purchased from Matrix Scientific (# 038023, lot: M15S). Cy5-tetrazine amine was purchased from Lumiprobe (lot ...
-
No products found
because this supplier's products are not listed.
Xingyue An, et al.,
bioRxiv - Immunology 2020
Quote:
... 2′-3’′cyclic guanosine monophosphate adenosine monophosphate (cGAMP) from Chemietek (Indianapolis, IN). 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) ...
-
No products found
because this supplier's products are not listed.
Junnosuke Nakamura, et al.,
bioRxiv - Physiology 2023
Quote:
... 1 mM DTT) and homogenized by DIGITAL HOMOGENIZER (As One International, Inc.). Lysates were centrifuged at 14,000 rpm for 5 min ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Lara N. Janiszewski, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Media with essentially no Zn was made by adding 3 µM 2-{[Bis(2-pyridinylmethyl)amino]ethylamino}benzenesulfonic (ZX1, an extracellular Zn chelator(61)) (Strem Chemicals, Inc.) to Chelex media ...
-
Carbohydrate
Cat# GMS0145S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Africa Fernandez-Nasarre, et al.,
bioRxiv - Immunology 2023
Quote:
... Keratinocytes were cultured in an incubator at 5% CO2 at 35°C in 6-well plates (Falcon) coated with PureCol bovine collagen I solution (Cell Systems) in low calcium homemade culture medium containing recombinant mEGF (Peprotech ...
-
No products found
because this supplier's products are not listed.
Arthur J. Jallet, Arnaud Le Rouzic, Anne Genissel,
bioRxiv - Evolutionary Biology 2019
Quote:
... 50 mL of frozen cell suspension were lyophilized for 3 days (LYOVACTM GT 2-E freeze dryer, Steris) and ground in liquid nitrogen to a fine powder with a mortar and pestle ...
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Kevin R. Theis, et al.,
bioRxiv - Microbiology 2019
Quote:
... placed into a sterilized Wheaton dounce reservoir (2 ml or 5 ml; DWK Life Sciences, Millville, NJ) containing 1 ml of sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Rebekah Honce, et al.,
bioRxiv - Microbiology 2021
Quote:
... and oseltamivir carboxylate (Toronto Research Chemicals, Lot 3-SKC-52-1, Purity 98%) with a qualified LC MS/MS assay ...
-
No products found
because this supplier's products are not listed.
Dávid Kovács, et al.,
bioRxiv - Cell Biology 2021
Quote:
... completed with 5% foetal bovine serum and 1% ZellShield (Minerva Biolabs). A549 cells were maintained in Dulbecco’s Modified Eeagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Tina Pekec, et al.,
bioRxiv - Physiology 2021
Quote:
... then 5 μM FeRhoNox™-1 solution (Goryo Chemical, Inc., Sapporo, Japan) was added and incubated in the dark at 37 °C for 1 h ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The established stable cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 4∼5% fetal calf serum (FCS; Thermo Fisher Scientific, or Nichirei Biosciences Inc) and 1% penicillin-streptomycin mixed solution (Nacalai Tesque ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Brigitta M. Laksono, et al.,
bioRxiv - Microbiology 2022
Quote:
... or fluorescein-labeled Sambucus nigra lectin (SNA) (5 μg/ml; EY Laboratories; BA-6802-1), respectively ...
-
No products found
because this supplier's products are not listed.
Mariano R. Rodríguez-Sosa, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Ad-MSC were incubated for 30 min with 1/3 dilution of Propidium Iodide (PI) solution (Cytognos, Spain) in PBS 1X ...
-
No products found
because this supplier's products are not listed.
Chandrashekhar D. Borkar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... retrogradely transported beads (0.2 μl, 1:2 diluted with saline, Lumafluor Inc., Durham, NC) were stereotaxically injected into the respective brain regions ...
-
No products found
because this supplier's products are not listed.
Dieter G. Müller, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Colchicine treatment was performed using a disk of filter paper of 6 mm diameter loaded with 1 mg of colchicine (Fluka, Honeywell Research Chemicals), which was placed in the centre of an agar plate filled with gametophyte material ...
-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Western Blots were incubated overnight at 4 °C in primary antibodies against PMP22 (1:1000, Assay Biotech), PTEN (1:1000 ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Ty S. Maughon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and one induced pluripotent stem cell derived MSC cell-line (Cellular Dynamics International, Madison WI) (Lot #0003 ...
-
No products found
because this supplier's products are not listed.
Wen Li, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the organic phase was prepared by mixing 20 μL siRNA (4 nmol in water) with 1 mL PLGA (Durect Corporation) (5mg/mL in acetone ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Ward Vleeshouwers, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were plated one day prior to measurements or transfection in Willco dishes (Willco Wells BV) at 400.000 cells/dish or in 96 well-plate (microplate BD Falcon ...
-
No products found
because this supplier's products are not listed.
Clémence Bernard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and (4) literature on interneuron connectivity (MEDLINE search for “gene name” and “synapse” and “interneuron”) ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Marina Barba-Aliaga, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and mixed with one volume of glass beads for further homogenization in a Precellys tissue homogenizer (Bertin Corp.). Lysates were cleared by centrifugation at 12000 rpm for 5 min at 4°C and protein extracts were assayed for firefly and Renilla luciferase activity sequentially in a 96-well luminometry plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... resuspended proteins were PEGylated for 1 hr at RT to label newly exposed cysteine thiols with the 5 kDa mass tag reagent (mPEG-5k, Badrilla SiteCounter™). Approximately 20 μl of each supernatant was saved as the “total input.” For immunoblot analysis ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 1x premix 4 to 7.3 ampholyte (Protein Simple) were loaded onto the capillaries ...
-
No products found
because this supplier's products are not listed.
Alec W. Stranahan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or Ara-C (LKT Laboratories, cat no: 147-94-4). For combination treatment studies with Zileuton (LKT Laboratories ...
-
No products found
because this supplier's products are not listed.
Wentao Yu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... An optical long-pass filter can be placed before the tube lens to further reduce the backscattered UV light. A custom-built 2-axis angle adjustable platform (Supplementary Fig. 2) under the vibratome (VF-700-0Z, Precisionary Instruments Inc.) ensures the focal plane of the objective lens is parallel with the surface of the sample sectioned by the vibratome ...
-
No products found
because this supplier's products are not listed.
Hiroki Matsuo, et al.,
bioRxiv - Plant Biology 2022
Quote:
Genomic DNA was extracted from 406 F2 individuals and one individual of each parent (B1 and G100) using Plant Genome DNA Extraction Mini Kits (Favorgen Biotech Corp., Changzi, Taiwan). DNA samples were diluted to a final concentration of 25 μL ...
-
No products found
because this supplier's products are not listed.
Chengfeng Xiao, Shuang Qiu,
bioRxiv - Genetics 2020
Quote:
... separated in 2 % gel of agarose (A87-500G, FroggaBio), and visualized with AlphaImager 2200 Gel Documentation and Image Analysis System (Alpha Innotech).
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Ekaterini Maria Lyras, et al.,
bioRxiv - Immunology 2022
Quote:
... Lyve-1 (ReliaTech 103-PA50AG; 1:500), Podoplanin (Biolegend 156202 ...
-
No products found
because this supplier's products are not listed.
Katy R. McCarron, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-LC3 (1:200 WB, 1:200 IF, Nanotools; 5F10), anti-p62 (1:1,000 WB ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... Jo-1 (Immunovision, JO1-3000) at 0.05 units/well ...