-
No products found
because this supplier's products are not listed.
Megan Chamberland, Brian Farrell, Johannes Yeh,
bioRxiv - Cell Biology 2022
Quote:
... 2 μm carboxylic acid functionalized silica spheres (Bangs Laboratory) were functionalized with octadecylamine (Sigma ...
-
No products found
because this supplier's products are not listed.
Ruchira Mukherji, et al.,
bioRxiv - Microbiology 2019
Quote:
... as well as a Kinetex Phenyl-hexyl column (50 × 2.1 mm, 1.7 µm, 100 Å, Phenomenex, for phenazine-1-carboxylic acid). Elution gradient ...
-
No products found
because this supplier's products are not listed.
David Forgacs, et al.,
bioRxiv - Immunology 2021
Quote:
... Plates were then washed 5 times with PBS/0.05% Tween20 prior to development with 100μL of 0.1% 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS, Bioworld, Dublin, OH, USA) solution with 0.05% H2O2 for 18 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
Fanny Georgi, et al.,
bioRxiv - Microbiology 2020
Quote:
... 3’-deoxy-3’-fluorothymidine (DFT, CAS number 25526-93-6) was obtained from Toronto Research Chemical, North York ...
-
No products found
because this supplier's products are not listed.
Charles J. Buchanan, et al.,
bioRxiv - Biophysics 2021
Quote:
6’-Sialyllactose sodium salt and 3’-Sialyllactose sodium salt were purchased from Carbosynth and used directly ...
-
No products found
because this supplier's products are not listed.
Dušan Veličković, et al.,
bioRxiv - Biochemistry 2023
Quote:
... placed onto double-sided adhesive copper tape (3-6-1182; 3M United States) adhered to indium tin oxide-coated glass slides (Bruker Daltonics ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
James A. D’Amour, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes of 4-6 MOhm resistance (borosilicate glass, World Precision Instruments, no. TW150F-3) were prepared on Narishige (PP-830 ...
-
No products found
because this supplier's products are not listed.
Esmeralda Vásquez Pacheco, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 × 105 cells were seeded per well in 6-well plates (Greiner Bio-One). The following day ...
-
No products found
because this supplier's products are not listed.
Zhibin Zhang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Frizzled-3 (FZD3; Uniprot ID: Q9NPG1) and Frizzled-6 (FZD6; Uniprot ID: O60353) were synthesized by GenScript. For FZD1 ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
No products found
because this supplier's products are not listed.
Huan Zhang, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples were placed on a microscope slide with 0.8% agarose gel containing 5 μM Bis-(1,3-dibutylbarbituric acid) trimethine oxonol (DiBAC4(3)) (Biotium) and 0.75 μM permeability reporter PI (MP Biomedicals) ...
-
No products found
because this supplier's products are not listed.
Rachel Thomas, et al.,
bioRxiv - Neuroscience 2021
Quote:
... okadaic acid (Cell Signaling): 0.2 or 1 µM ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... phenazine-1-carboxylic acid (PCA, Ark Pharm); phenazine-1-carboxamide (PCN ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Jeffrey L. Platt, et al.,
bioRxiv - Immunology 2021
Quote:
... The reaction was visualized by subsequent addition of 2,2′-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) substrate (Southern Biotech, #0202-01).
-
No products found
because this supplier's products are not listed.
Kacey Mersch, et al.,
bioRxiv - Biophysics 2020
Quote:
... 20 mM 3-(N-morpholino)propanesulfonic acid (MOPS, RPI), 5 mM DM ...
-
No products found
because this supplier's products are not listed.
Marie-Laure Fogeron, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 6 mM amino acid mixture (average concentration of each amino acid 0.3 mM) and 0.1% (w/v) MNG-3 (Maltose Neopentyl Glycol-3, Anatrace). The feeding buffer contained 1x SUB-AMIX buffer (CellFree Sciences Japan) ...
-
No products found
because this supplier's products are not listed.
J Muir, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3-(2-carboxypiperazin-4-yl) propyl-1phosphonic acid (CPP, 10 mM; HelloBio). Inhibitory postsynaptic currents (IPSCs ...
-
No products found
because this supplier's products are not listed.
Matthias M. Zimmer, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... RNAs were labeled at the 3’ end using pCp-Cy5 (Cytidine-5’-phosphate-3’-(6-aminohexyl) phosphate) (Jena Biosciences). For each binding experiment ...
-
No products found
because this supplier's products are not listed.
Xiao-Wei Zhang, et al.,
bioRxiv - Physiology 2021
Quote:
... or pretreated with 75 μM indole-3-acetic acid (IAA, Solarbio, Beijing, China), 50 μM 1-naphthylphthalamic acid (NPA ...
-
No products found
because this supplier's products are not listed.
Liam McCarthy, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
6 well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black frame,...
Cat# P06-1.5H-N,
20/case, $249.00
Ask
R. A. Petazzi, et al.,
bioRxiv - Biophysics 2020
Quote:
... 3-6 · 105 cells were plated onto 35 mm glass-bottom dishes (CellVis, Mountain View ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Raisa I. Krutilina, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
No products found
because this supplier's products are not listed.
Natalia Benetti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
Prepared to contain high collagenase activity with a caseinase to collagenase ratio of ~2:1....
Cat# LS005318,
100 mg, $60.00
Ask
Miqdad O. Dhariwala, et al.,
bioRxiv - Immunology 2020
Quote:
... and skin was minced finely with dissection scissors and mixed in a 6-well plate with 3 ml of digestion buffer consisting of 0.8 mg/ml Collagenase Type 4 (4188; Worthington), 0.02 mg/ml DNAse (DN25-1G ...
-
No products found
because this supplier's products are not listed.
Emily G. Kuiper, et al.,
bioRxiv - Biochemistry 2019
Quote:
... was monitored during unfolding over a linear temperature gradient (35-95 °C) over 3 minutes on a Tycho NT.6 instrument (NanoTemper). The temperature at which a transition occurs in a plot of the first derivative of the fluorescence ratio (350/330 nm) ...
-
No products found
because this supplier's products are not listed.
Samantha Sarni, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
Sera were collected from SARS-CoV-2-infected mice at 3 and 6 dpi by centrifugation of whole blood in GelZ serum separation tubes (Sarstedt). BAL samples were recovered by insufflation of lungs with 1 ml sterile PBS followed by aspiration to collect ∼0.5ml volume of fluid ...
-
No products found
because this supplier's products are not listed.
Jacob Rose, et al.,
bioRxiv - Cell Biology 2021
Quote:
... peptide mixtures were transferred onto a trap chip (with 200 μm x 6 mm ChromXP C18-CL chip, 3 μm, 300 Å, SCIEX) and washed at 2 μL/min for 10 min with the loading solvent (H2O/0.1% formic acid) ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 6-Azidohexanoic Acid Ester (Click Chemistry tools, > 95%), Alkyne-PEG4-NHS Ester (Click Chemistry Tools > 95%) ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
No products found
because this supplier's products are not listed.
Peng Bao, et al.,
bioRxiv - Microbiology 2021
Quote:
... Pyruvic acid sodium (>98%, CAS number: 113–24–6) was purchased from Amresco, USA ...
-
No products found
because this supplier's products are not listed.
Seraphine Kamayirese, et al.,
bioRxiv - Biochemistry 2023
Quote:
(His)6-14-3-3ε was commercially obtained from Novus Biologicals (Centennial CO, USA), and 14-3-3ε-(His)12 was expressed in our laboratory (see details on protein expression in the supporting information) ...
-
No products found
because this supplier's products are not listed.
David G. Saliba, et al.,
bioRxiv - Immunology 2019
Quote:
SUV mixtures were injected into flow chambers formed by sealing acid piranha cleaned glass coverslips to adhesive backed plastic manifolds with 6 flow channels (StickySlide VI 0.4; Ibidi) (16) ...
-
No products found
because this supplier's products are not listed.
Dongdong Chen, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Mycoplasma testing was performed every 3-6 months using the Mycoplasma test kit (PromoCell, PK-CA91-1024) and on an ad hoc basis.
-
No products found
because this supplier's products are not listed.
Sanchari Datta, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cells were treated with a mix of 200μM non-radiolabeled palmitate (BSA conjugated at 6:1) and 0.15μCi [1-14C] palmitic acid (American Radiolabeled Chemicals, ARC 0172A) conjugated with 10μM BSA for 15 ...
-
No products found
because this supplier's products are not listed.
Eden L. Sikorski, et al.,
bioRxiv - Immunology 2021
Quote:
... The free amine of the lysine side chain was coupled to 3-maleimidopropionic acid (2 equivalents, Chem-Impex #14709) using HBTU and DIEA for 2 hours at room temperature (Scheme S1) ...
-
No products found
because this supplier's products are not listed.
Alexis S. Bailey, Margaret T. Fuller,
bioRxiv - Developmental Biology 2023
Quote:
... TSA plus cyanine 3 solution (dilute TSA-Cy3 1:250 in 100mM Boric Acid, pH8.5 containing 0.003% H2O2) (Akoya Biosciences) was added to the tissue sections and incubated for 10 min at RT ...
-
No products found
because this supplier's products are not listed.
Yue Qu, et al.,
bioRxiv - Neuroscience 2021
Quote:
The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
No products found
because this supplier's products are not listed.
Koetsu Inoue, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and anti-mouse PD-1 antibodies (clone RMP1-14, 10 mg/kg, 6 doses, every 3 days) were purchased from BioXcell. All drug treatments were administered intraperitoneally (i.p.).
-
No products found
because this supplier's products are not listed.
Tegan S. Horan, et al.,
bioRxiv - Genetics 2023
Quote:
... the cell pellet was resuspended in PBS supplemented with 2 % FCS and nucleated cells were counted in methylene blue with 3 % acetic acid on a Vi-Cell XR cell viability counter (Beckman Coulter). 10 × 106 bone marrow cells were resuspended in 200 μl of PBS supplemented with 2 % FCS containing the following antibody solution ...
-
No products found
because this supplier's products are not listed.
R. A. Petazzi, et al.,
bioRxiv - Biophysics 2020
Quote:
... 3-6 · 105 cells were plated onto 35 mm glass-bottom dishes (CellVis, Mountain View, CA or MatTek Corp., Ashland, MA) 48 h prior to the experiment and transfected as described above ...
-
No products found
because this supplier's products are not listed.
Luis M. Rodríguez-Pérez, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ependyma-denuded ventricle surface percentage was quantified from micrographs (3-6 brain sections per animal) scanned under fluorescence in an Olympus VS120 microscope (Olympus, Tokyo, Japan) with a 10x objective.
-
No products found
because this supplier's products are not listed.
Amy Krans, et al.,
bioRxiv - Neuroscience 2019
Quote:
... p62 (Proteintech, 1:1000, acid AR), ubiquitin (DAKO ...
-
Coumarin-3-carboxylic acid is used as a detector for hydroxyl radicals (.OH) in aqueous solution.
Cat# S9361, SKU# S9361-25mg,
25mg, $97.00
Ask
Cecilia Roux, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 2 uM retinoic acid (Selleck Chemicals), 0.66 uM JQ1 (Selleck Chemicals) ...
-
TeloCol®-6 is 50 mL of 6 mg/ml, type I bovine telocollagen solution for 2D coatings or 3D...
Cat# 5225-1KIT,
50 mL, USD $440.0
Ask
Colin D. Paul, et al.,
bioRxiv - Bioengineering 2019
Quote:
Cytosoft 6-well plates (Advanced BioMatrix, San Diego ...
-
No products found
because this supplier's products are not listed.
Shane Breznak, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 6 ug of rabbit IgG (Jackson Immunoresearch) or rat-HA antibodies for 3 hours with rotation at 4°C ...