-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Zhi-Peng Chen, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1mM dithiothreitol (DTT) and 1×ethylene diamine tetraacetic acid (EDTA) free protease inhibitor cocktail (TargetMol). The suspension was frozen in liquid nitrogen and stored at −80°C for further use.
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Lisa Mohr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 4°C for 10 min and 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Alessandro Bonadio, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Gene blocks of MMP-9Cat variants Des 3 and Des 4 were purchased from IDT DNA, USA ...
-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 6 or 7 of embryoid body culture (Extended Data Fig. 4) was done using Imaris (version 9.1.2, Oxford Instruments). Intensity of transcription spots were quantified using the ‘Spots’ tool calculated as the mean of pixels within an ovoid shape of 1 μm x 1 μm x 3 μm in size (x,y,z dimensions respectively) ...
-
No products found
because this supplier's products are not listed.
Qin Yang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... RNP complexes consisting of 4 µM sgRNA (IDT or Synthego) and 3 µM SpyCas9 protein (PNA Bio) were prepared in Buffer R provided by the Neon Transfection System Kit to a volume of 6 µl ...
-
No products found
because this supplier's products are not listed.
Daniel Rüdiger, et al.,
bioRxiv - Cell Biology 2019
Quote:
... a 4 mg/ml collagen I gel (produced according the protocol) and a 6 mg/ml laminin gel (Trevigen, Gaithersburg, USA) were mixed on ice ...
-
No products found
because this supplier's products are not listed.
Alexandra A.M. Fischer, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... ACC 635) and U2OS 2-6-3[67] cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, PAN Biotech, catalog no. P04-03550) completed with 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Stephen B. McHugh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sections were then incubated with primary antibodies diluted in 3% NDS blocking solution and incubated at 4 °C for 72 hours (GFP anti-chicken, 1:1,000, Aves Labs, catalog no ...
-
No products found
because this supplier's products are not listed.
Mariève D. Boulanger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were reacted for 2 h with 150 μL/cm2 of a 3 mg/mL suspension of sulfo-succinimidyl-4-(p-maleimidophenyl)-butyrate (S-SMPB, #BC24, G-Biosciences) in phosphate buffered saline solution (PBS ...
-
No products found
because this supplier's products are not listed.
Kunal Sharma, et al.,
bioRxiv - Microbiology 2021
Quote:
... the bladder-chip was attached to an adhesive conductive surface followed by coating with a 3 – 4 nm thick layer of gold palladium metal (Quorum Q Plus, Quorum Technologies). Images of the cells were captured using a field emission scanning electron microscope (Merlin ...
-
No products found
because this supplier's products are not listed.
Zeynep Cakir, et al.,
bioRxiv - Neuroscience 2022
Quote:
Peptides were resuspended in 4% formic acid and 3% acetonitrile and directly injected on a 75 μm ID column (New Objective) packed with 25 cm of Reprosil C18 1.9 μm ...
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 6-Azidohexanoic Acid Ester (Click Chemistry tools, > 95%), Alkyne-PEG4-NHS Ester (Click Chemistry Tools > 95%) ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Shaohe Wang, Kazue Matsumoto, Kenneth M. Yamada,
bioRxiv - Developmental Biology 2020
Quote:
... 4 mL 5× PEG reagent (System Biosciences, LV825A-1) was added and mixed by pipetting ...
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
Junfang Song, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Oligonucleotides labelled with fluorescein at their 3’-termini were synthesized using 6-fluorescein CPG columns (Glen Research 20-2961). Oligonucleotides were radioactively [5’-32P]-labelled using [γ-32P] ATP (Perkin Elmer ...
-
No products found
because this supplier's products are not listed.
Christina Strauch, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and nuclei were visualized using 4’,6-diamidino-2-phenylindole (DAPI) in mounting medium (SCR-038448; Dianova, Hamburg, Germany).
-
No products found
because this supplier's products are not listed.
Valeria Garcia-Flores, et al.,
bioRxiv - Immunology 2022
Quote:
... the slides were incubated with DAPI (4′,6-diamidino-2-phenylindole) as a nuclear counterstain and mounted using AquaSlip™ Aqueous Permanent Mounting Medium (American MasterTech). Fluorescence image acquisition was performed using the Vectra Polaris Multispectral Imaging System at 20x magnification ...
-
No products found
because this supplier's products are not listed.
Beibei Wu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Isolates were cultured on Middlebrook medium for 4-6 weeks at 37°C and DNA was extracted using magnetic beads (Tiangen Biotech Co., Ltd.). Rifampicin and isoniazid drug-susceptibility testing was performed using the proportion method in Löwenstein-Jensen medium (Aziz et al ...
-
No products found
because this supplier's products are not listed.
Erika K. Ramos, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cells were seeded into 6-well or 12-well plates at a concentration of 2,000 or 1,000 cells per well in replicates of 3 or 4 using Prime-XV Tumorsphere Serum Free Media (Irvine Scientific). Cells were monitored for up to 17 days ...
-
No products found
because this supplier's products are not listed.
Adar Sonn-Segev, et al.,
bioRxiv - Biophysics 2019
Quote:
... and the supernatant applied for 3 h at 4°C to 5 mL of Toyopearl AF-Chelate-650M resin (Tosoh) precharged with Ni2+-ions ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Haley M. Scott, et al.,
bioRxiv - Immunology 2023
Quote:
... Lenti-X cells were transfected with a pSICO scramble non-targeting shRNA construct and pSICO Srsf7 shRNA constructs targeted at exon 3 and exon 4 of Srsf7 using Polyjet (SignaGen Laboratories). Virus was collected 24 and 48 h post transfection ...
-
No products found
because this supplier's products are not listed.
Andrew Barszczyk, et al.,
bioRxiv - Cell Biology 2023
Quote:
... alkaline phosphatase conjugated antibodies were detected colourometrically using BCIP/NBT (nitro-blue tetrazolium and 5- bromo-4-chloro-3’-indolyphosphate) Substrate Solution (#BE116.100ML; Bio Basic Canada Inc). For analysis of bands ...
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-6 (Lot: 449268JEI6, Elabscience, China), and IL-10 (Lot ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Shih-Heng Chen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... pAAV2/6 (Cell Biolabs Inc., Cat# VPK-426), pAAV2/8 (Cell Biolabs Inc. ...
-
No products found
because this supplier's products are not listed.
Maximilian Lenz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and TTX (0.5 μM; Biotrend #18660-81-6) were added to the external solution ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Miguel Ricardo Leung, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-SPACA9 (HPA022243 from Atlas Antibodies, used at 6 μg/mL), or no primary antibody diluted in blocking buffer for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Alexis S Mobley, et al.,
bioRxiv - Immunology 2021
Quote:
... and APC-IL-4 (Tonbo Bioscience) for 30 minutes at 4◦C ...
-
No products found
because this supplier's products are not listed.
Meng Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 12-port valves (IDEX, EZ1213-820-4) and a peristaltic pump (Gilson ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Ariane Zutz, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The isolated fractions were separated on SDS-PAGE (RunBlue 4-20 %, Expedeon; NuPAGE®Bis-Tris gel 4-12%, Invitrogen) and analysed by InstantBlue staining (Expedeon ...
-
No products found
because this supplier's products are not listed.
Uwe Schwartz, et al.,
bioRxiv - Microbiology 2023
Quote:
... 4 hpi using TRI Reagent (Molecular Research Center, Inc.). Two time series sets of total RNA were prepared from two independent infections ...
-
No products found
because this supplier's products are not listed.
Alan B. Dogan, Horst A. von Recum,
bioRxiv - Bioengineering 2020
Quote:
... Propargyl-PEG1000-amine and PEG3000-diamine was purchased from BroadPharm (San Diego, CA). Cuprisorb was purchased from Seachem Laboratories (Madison ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Janani Ramachandran, et al.,
bioRxiv - Developmental Biology 2023
Quote:
Differential SMARCC1 binding between E11.5 (40-43s) control (Gli3+/+; n=3) and Gli3-/- (n=4) samples was conducted using an E.coli spike-in (EpiCypher 18-1401) of 0.125ng/sample ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (4) Spin-coating LOR3A photoresist (MicroChem) at 4000 rpm ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Takaoki Kasahara, et al.,
bioRxiv - Genomics 2022
Quote:
... or 6 along with its flanking intron regions containing appropriate restriction enzyme sites was synthesized (Biomatik or Genewiz). Each exon of mouse Asmt gene in pcDNA5-FRT-TO was replaced with the human form using the appropriate restriction enzymes ...