-
No products found
because this supplier's products are not listed.
Wolfgang G. Pfeifer, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Excess sample solution was subsequently wicked off with filter paper (Whatman #4) and the grid stained with two 6 µl drops of 1% aqueous Uranyl acetate (SPI Supplies) solution ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Carolina Rosselot, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Exendin-4 plasma levels were measured using the exendin-4 EIA kit (Phoenix pharmaceuticals, Burlingame, CA). Harmine was measured in plasma by liquid chromatography–mass spectrometry analysis by WuXi AppTec (Cranbury ...
-
No products found
because this supplier's products are not listed.
Kristen R. Breit, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 11-Hydroxy-Δ9-THC (Cerilliant H-026-1mL), and 11-nor-9-Carboxy-Δ9-THC (Cerilliant T-018-1ML ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Hironobu Endo, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4.50-4.40 (m, 1H), 4.12-4.00 (m, 3H), 2.81 (d, J = 4.6 Hz, 3H)) were custom-synthesized (Nard Institute). NMR spectra were obtained on a JEOL ECS-400 spectrometer at 400 MHz ...
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
Vignesh Jayarajan, et al.,
bioRxiv - Cell Biology 2022
Quote:
The ROCKi inhibitor Y-27632 ((R)-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide-2) was purchased from AdooQ Bioscience (#A1101 ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
... Eluted fractions were run 1-2 centimeters into a 4-20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry ...
-
No products found
because this supplier's products are not listed.
Jamilla Akhund-Zade, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
The MA and FL traps were created by cutting an approximately 2 inch-square flap into an empty one-gallon plastic ethanol jug (Koptec, Decon Labs) and baiting them with a fruit and wine mixture ...
-
No products found
because this supplier's products are not listed.
Sydney Morrill, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10 µL of washed bacterial samples (∼6×105 CFU) were transferred to a 96-well plate and exposed to 4% pooled normal human serum (NHS) (Complement Technologies) in wash buffer ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
Cat# 1882-77-5,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rats received one intraperitoneal injection of 5-Ethynyl-2’-deoxyuridine (EdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 61135-33-9) and were killed 6 (CTL n = 8 ...
-
No products found
because this supplier's products are not listed.
Layla Drwesh, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 4 °C) and the supernatants were incubated overnight with 2 mL Ni-NTA Agarose beads (Cube Biotech). The bound proteins were washed with 20 mL wash buffer (40 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Brandon C. Farmer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... aged 2-4 months (young) and group housed in sterile micro-isolator cages (Lab Products, Maywood, NJ), and fed autoclaved food and acidified water ad libitum ...
-
No products found
because this supplier's products are not listed.
Yuka Sakata, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antigens were retrieved using HistoVT One (Nacalai USA) for 20 min at 70 °C and washed in PBS for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Yu-Ling Lin, et al.,
bioRxiv - Neuroscience 2022
Quote:
Mice were deeply anesthetized with isoflurane (4% induction, 1.5%–2% maintenance in O2; Halocarbon Laboratories, North Augusta, SC, USA) and placed in a stereotaxic injection frame (IVM-3000 ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... or 4-dimethylaminophenylazophenyl-4’-maleimide (DABMI, Setareh Biotech). After labeling ...
-
No products found
because this supplier's products are not listed.
Rashmi Chandra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... loaded with one zirconia silica bead (2.3 mm, OPS Diagnostics) per well ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Kathrin Frey, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All-in-one ready-to-use (Cell Applications Inc, 211A-500) without antibiotics.
-
No products found
because this supplier's products are not listed.
Snježana Kodba, et al.,
bioRxiv - Cell Biology 2024
Quote:
... one well of an 8-well Ibidi chambers (IBI Scientific #80807) was coated with 10 mg/mL Laminin (Sigma ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... sections were pre-incubated in 4% PFA (in 0.1 M PB) for ≥2 days at 4°C before processing with the FD NeuroSilver™ kit II (FD Neurotechnologies, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Julian M. Jimenez, et al.,
bioRxiv - Bioengineering 2022
Quote:
Homogeneous fibrin gels were prepared to final fibrinogen concentrations of 2 and 4 mg/mL by combining human fibrinogen (FIB3, Enzyme Research Laboratories) and Alexa Fluor (AF ...
-
No products found
because this supplier's products are not listed.
Daniel Spakowicz, et al.,
bioRxiv - Genomics 2019
Quote:
... RNA was purified using the All-in-One purification kit (Norgen Biotek) and its integrity was assayed by an Agilent bioanalyzer (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
David Z. Bushhouse, Julius B. Lucks,
bioRxiv - Molecular Biology 2022
Quote:
... using EconoSpin® All-in-One mini spin columns (Epoch Life Science). IVT linear template was eluted from spin columns using 50 μL UltraPure™ DNase/RNase-Free Distilled Water (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Maitreyi S. Joshi, et al.,
bioRxiv - Systems Biology 2022
Quote:
... atto-590azide (6 mM, ATTO-TEC GmbH, Siegen, Germany) dissolved in DMSO was mixed with aqueous solution of click-chemistry grade CuSO4 (40mM ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
G. Uppal, et al.,
bioRxiv - Biophysics 2020
Quote:
... The PEG-RGD and 4-arm PEG-acrylate (4-PEG-ACR, 20kDa, JenKem Technology) were mixed at a 1.5:8.5 (w/w ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Adam McNee, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated with 2 μg/ml rec 2-12C (Absolute Antibody) in PBS-T overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Gab-Chol Choi, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and bone morphogenetic protein 2 (BMP-2) (1:200, orb251474, Biorbyt) primary antibodies at 4°C ...
-
No products found
because this supplier's products are not listed.
Craig T. Connors, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 6 weeks-of-age were analyzed by ELISA for insulin (Alpco) and glucagon content (Mercodia) ...
-
No products found
because this supplier's products are not listed.
Pinja Kettunen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM Xav939 (BioGems).
-
No products found
because this supplier's products are not listed.
Winifred M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... 4-hydroxybenzoic acid-d4 from CDN Isotopes, and sodium taurocholate-d5 from Toronto Research Chemicals through Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Marie-Françoise Montaron, et al.,
bioRxiv - Neuroscience 2020
Quote:
One-of-ten series was incubated with a rat monoclonal anti-BrdU antibody (1/200, Accurate Chemical) and with a mouse monoclonal anti-NeuN antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... was added to sample 2 (DUBPAN) and 2 μl of OTUB1 (LifeSensors, Cat#: DB201) was added to sample 3 (DUBK48) ...
-
No products found
because this supplier's products are not listed.
Naomi E. Widstrom, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2 mM ATP) and 2 ug of recombinant kinase (SignalChem; Tyro3 (aa 455-end): T22-11G ...
-
No products found
because this supplier's products are not listed.
Saurav Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... pMD2.G and psPAX2 in 2:1:2 ratio with PolyJet transfection reagent (SignaGen Laboratories). Media were harvested two days later and added to recipient cells with 1 μg/ml polybrene (Sigma ...
-
No products found
because this supplier's products are not listed.
Christina Hipfinger, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Samples were prepared by loading the middle cages of 4×4 LEGO scaffolds with VEGF supplemented GelMA microgels and the supplementary peripheral cages with BMP2 (Shenandoah Biotechnology, Inc.) supplemented with GelMA microgels ...
-
No products found
because this supplier's products are not listed.
Matthew J Rames, et al.,
bioRxiv - Biophysics 2023
Quote:
... and 50 nm gold particles (BBI Solutions, EM.GC50/4). Fixation was performed using a buffer made from ...
-
No products found
because this supplier's products are not listed.
Daan Vorselen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and streptavidin (Neuromics, 2-0203-100) in PBS (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Dimitrios Papagiannidis, et al.,
bioRxiv - Cell Biology 2021
Quote:
... One-hundred microliters of each sample was transferred into 96 well glass bottomed microtiter plates (Brooks Life Sciences, Chelmsford, Massachusetts) coated with concanavalin A and allowed to attach ...
-
No products found
because this supplier's products are not listed.
T. van den Broek, et al.,
bioRxiv - Immunology 2023
Quote:
ANA (Hep-2) slides (AN-1012, MBL International) and anti-neutrophil cytoplasmic antibody (ANCA ...
-
No products found
because this supplier's products are not listed.
Aki Teranishi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... the mechanosensitive cation channel inhibitor (e.g., Piezo1, TRPC1/6) GsMTx4 (Abcam or Peptide Institute, 2.5 μM, 15-min incubation)l the intracellular calcium chelator BAPTA-AM (Tronto Research Chemicals ...
-
No products found
because this supplier's products are not listed.
Alexandra Tsirigotaki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The hLeptin:hLEP-RCRH2 complex (6 mg/mL) was subjected to crystallization trials using a Mosquito liquid handling robot (TTP Labtech) in sitting drop format ...
-
No products found
because this supplier's products are not listed.
Ryan Choi, et al.,
bioRxiv - Microbiology 2021
Quote:
... a 4 nucleotide chimeric substrate was commercially synthesized (IDT DNA Inc., Coralville, IA) with a 5’ carboxyfluorescein (FAM ...
-
No products found
because this supplier's products are not listed.
Jessica M. Miller, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Fluo-4 fluorescence transients were recorded via a standard filter set (#49011 ET, Chroma Technology). Resting fluorescence was recorded after cessation of pacing ...