-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Quality controls of A1cNow kit were performed with NOVA-ONE kit levels 1 & 2 (NOVA-ONE Diagnostics, Calabazas, CA).
-
No products found
because this supplier's products are not listed.
Hiroki Miyahara, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and stained with 4ʹ ,6-diamidino-2-phenylindole (DAPI) for 10 min prior to mounting in FluoromountTM (K024, Diagnostic BioSystems, California, USA). Samples for ThT staining were treated with 1% ThT for 3 min and differentiated in 1% acetic acid for 15 min ...
-
No products found
because this supplier's products are not listed.
Atiq Faramarz, et al.,
bioRxiv - Cell Biology 2019
Quote:
... for 2–4 h and fluorescence (560Ex/590Em) was measured in a microplate reader (TriStar LB 941, Berthold Technologies). To monitor cell growth of RPE1 cells ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Vivian Tam, et al.,
bioRxiv - Systems Biology 2020
Quote:
... (McGill University) and one aged (59M) from Articular Engineering, LLC (IL ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Sergio M. Pontejo, Philip M. Murphy,
bioRxiv - Immunology 2020
Quote:
... Plates were developed with TMB One Component (Surmodics, Eden Prairie, MN) and the reaction was stopped with sulfuric acid before measuring the absorbance at 450 nm (A450 ...
-
No products found
because this supplier's products are not listed.
Yedan Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... One fiber-optic probe (91-00124, Perimed Inc., Las Vegas, NV) coupled with a laser-Doppler flowmeter (LDF ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... 4% mouse serum (ImmunoReagents) and 4% goat serum ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Haoyang Chen, et al.,
bioRxiv - Bioengineering 2023
Quote:
... One tube (left side in Fig. S5a) was filled with defibrinated bovine blood (Lampire biological laboratories, Pipersville, PA, USA) while circulated using a peristatic pump (model 3386 ...
-
No products found
because this supplier's products are not listed.
Jae Yeong Ha, et al.,
bioRxiv - Pathology 2023
Quote:
... Tissue samples were analyzed using the ELISA kits for IL-6 (KET7009; Abbkine, Wuhan, China) and TNF-α (ADI-900- 047 ...
-
No products found
because this supplier's products are not listed.
Zhifen Cui, et al.,
bioRxiv - Microbiology 2021
Quote:
... were generated by simultaneously mixing one volume of lipid mixture (25 : 5: 19.3 : 0.8 : 50 molar ratio) of DLin-MC3-DMA (MedKoo Biosciences, #555308), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine ...
-
No products found
because this supplier's products are not listed.
Wouter H. van Megen, et al.,
bioRxiv - Physiology 2021
Quote:
... and one group received infusion with 20 mg/ml etelcalcetide hydrochloride via Alzet osmotic 2001 minipumps (Durect Corporation, Cupertino, CA, USA) with a delivery rate of 1.0 μl/hr ...
-
No products found
because this supplier's products are not listed.
Christopher J. Emig, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... SARS-CoV-2 Delta Variant pseudovirus (eEnzyme) was diluted 1:2 in DMEM complete media to a pseudoviral particle concentration of 5e7/ml ...
-
No products found
because this supplier's products are not listed.
Yun Liu, Weichun Lin,
bioRxiv - Neuroscience 2022
Quote:
... μ-conotoxin GIIIB (2 μM; Peptides International) was added to the bath solution 30 minutes prior to recording ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... BYL719 at 2 or 10 μM (Chemietek) and 2 nM BMP6 (R&D ...
-
No products found
because this supplier's products are not listed.
Chenxin Li, et al.,
bioRxiv - Plant Biology 2022
Quote:
Catharanthus roseus cv ‘SunstormTM Apricot’ leaf tissue collected at the same time as one replicate of the 10x scRNA-seq experiments was used with the Proximo Hi-C kit (Phase Genomics; CRO_AR) to generate Hi-C reads and sequenced on the Illumina NovaSeq 6000 generating paired-end 150 nt reads ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Slides were stained in Hematoxylin (Gill’s 2x) (RICCA) for 2 minutes and dipped 1-2 times in bluing solution (ScyTek Laboratories). The slides were next counterstained in eosin and dehydrated using washes of 95% ethanol ...
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
No products found
because this supplier's products are not listed.
Cheryl Immethun, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The cultures were loaded into a Greiner CELLSTAR® bio-one sterile 48 well culture plate and covered with a Breathe-Easy® Gas Permeable Sealing Membrane (Diversified Biotech). Cultures were then incubated in the dark at 30°C in ambient air for 72 hours at 275 rpm ...
-
No products found
because this supplier's products are not listed.
Ryutaro Ariyoshi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and MTG mutant was purified with size exclusion chromatography using ProteoSEC-D 16/60 6-600 HR (Protein Ark) with PBS (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Jonathan M. Warawa, et al.,
bioRxiv - Microbiology 2022
Quote:
... Neutropenia (>90% depletion) was confirmed by complete blood cell counts one day prior to infection using a Hemavet 950 (Drew Scientific, Miami Lakes, FL). Group sizes for all studies were 10 animals ...
-
No products found
because this supplier's products are not listed.
Ulri N. Lee, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 2 g of Yeast Extract (United States Biological Corporation ...
-
No products found
because this supplier's products are not listed.
Ruth I. Connor, et al.,
bioRxiv - Immunology 2023
Quote:
... Omicron BA.1 or Omicron BA.2 (Immune Technology) diluted to 5 μg/ml in 1X PBS and incubated overnight at 4 °C ...
-
Cat# F107,
USD $169.00/EA
Ask
Ekaterina V. Tarasovetc, et al.,
bioRxiv - Cell Biology 2020
Quote:
... blocked with 2 mM biotinylated dPEG (2.5 kDa, Quanta BioDesign), washed extensively by centrifuging three times at 2,000 g ...
-
No products found
because this supplier's products are not listed.
Rajashree A. Deshpande, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 2 µL of 100 µM caged AluGG crRNA (Bio-Synthesis)36 was mixed with 2 µL of 100 µM tracrRNA (Integrated DNA Technologies ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Agnes Ulfig, et al.,
bioRxiv - Biochemistry 2019
Quote:
α2-Macroglobulin was purified from human plasma (obtained from Zen-Bio, Inc. ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Vincenzo Davide Aloi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and treated overnight at 4°C with the primary antibody (rabbit anti-pERK; 1:200, PhosphoSolutions). The pre-treated sections were then incubated for 2 hours at room temperature with goat anti-rabbit conjugated to Cy3 ...
-
No products found
because this supplier's products are not listed.
Kelli K. Mullane, et al.,
bioRxiv - Microbiology 2022
Quote:
... fitted with a pressurizable 2-leg rubber septum (DWK Life Sciences, New Jersey, USA) was filled completely with low percentage (0.3% ...
-
Glucose-6-Phosphate Dehydrogenase Kit
Cat# DGPDH-100,
1.0 kit, 100 tests, USD $339.0
Ask
Megan K. DeBari, et al.,
bioRxiv - Bioengineering 2021
Quote:
Media was collected on day 4 and glycerol concentrations were measured using a glycerol assay (BioAssay Systems, Hayward, CA). The assay was performed following the manufacturer’s procedure ...
-
No products found
because this supplier's products are not listed.
J. Graham Ruby, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... Animal cages were changed every 2 weeks within a cage change station (NuAire, Plymouth, MN). Mice were transferred between cages using red transparent acrylic tunnels (Bio-Serv ...
-
No products found
because this supplier's products are not listed.
Avani Yeola, et al.,
bioRxiv - Cell Biology 2020
Quote:
... muscle of 3-4-month-old female SCID/Beige mice was injured by injection with 15 µL of 10 µM cardiotoxin (Latoxan). Confocal images of 3-4 serial sections/mouse were captured by Zen core/ AxioVision (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Nikhil Pandey, Priyanka Mishra,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The intensity of COX-2 was determined using image quant Omega Flour TM (GEL Company, USA) using Omega Fluor Acquisition software ...
-
No products found
because this supplier's products are not listed.
Mesfin Meshesha, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and SARS-CoV-2 lineage B.1.1.529 (Omicron Variant) culture fluid (UV inactivated, 0810642UV, Zeptometrix LLC, USA) and (heat inactivated ...
-
No products found
because this supplier's products are not listed.
Aubin Ramon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SarS-CoV-2 RBD was purchased as biotinylated purified protein from CUSABIO (product code CSB-MP3324GMY1-B) and stored at -80 °C.
-
No products found
because this supplier's products are not listed.
Brett E. Johnson, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Immunofluorescence analyses of tumor tissue: FFPE human tissues were sectioned at 4 μm and mounted on adhesive slides (Mercedes Medical, TNR WHT45AD). The slides were baked overnight in an oven at 55 °C (Robbin Scientific ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
MULTI-ARRAY Standard 96-well plates (Meso Scale Diagnostics, Rockville, Maryland) were coated overnight at 4°C with K1 anti-dsRNA mouse monoclonal antibody (SCICONS, Budapest, Hungary). Plates were blocked using 5% MSD Blocker A (Meso Scale ...
-
No products found
because this supplier's products are not listed.
Dongjin S Shin, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Briefly, 20 mL of light mineral oil (O121-4, Fisher) was placed in a 100 mL microcarrier spinner flask (Bellco Glass Inc.) located in a preheated in water bath (37 °C) ...
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...