-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Mohammad Tohidul Amin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and 3-hydroxyvaleric acid (AdooQ BioScience, Irvine, CA).
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
No products found
because this supplier's products are not listed.
Wenyang Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Blots were washed 3 times with Tris Buffered Saline-Tween (TBST) buffer (Boston BioProducts, Cat. # IBB-181–6) and developed using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Ana Cristina Colabardini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cell lysis was processed by 6 times beating for 3 minutes with ∼100 μl volume of silica beads using Bullet Blender (Next Advance) with at least 3 minutes of cooling in between each cycle ...
-
No products found
because this supplier's products are not listed.
Rachel Bezalel-Buch, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 39mer 8 atom 6 bp ICL (39+6 DMEDA ICL) were synthesized and purified as previously reported (33) ...
-
No products found
because this supplier's products are not listed.
Shijie Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
Di-docosahexaenoyl (22:6) bis (monoacylglycerol) phosphate (di-22:6-BMP) was measured in plasma and exosome-depleted urine and CSF by ultra-performance liquid chromatography – tandem mass spectrometry (UPLC-MS/MS) ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Qingtao Sun, et al.,
bioRxiv - Neuroscience 2023
Quote:
Biotinylated human IL-6 solution (Acrobiosystems, IL-6-H8218 ...
-
No products found
because this supplier's products are not listed.
Redife Aslihan Ucar, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 3N hydrochloric acid (HCl) (Spectrum Chemicals). pH measurements were taken using an Accumet® Research 25 pH meter (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Johannes Yayo, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Waters amino acid standard solution with 17 amino acids (cat. no. WAT088122) was mixed with glutamine (Irvine Scientific, Tilburg, The Netherlands), asparagine ...
-
No products found
because this supplier's products are not listed.
Miles H. Black, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 50 μM 6-biotin-17-NAD+ (Trevigen). Reactions were incubated at 37 °C for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Cody Moore, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or recombinant ATF-6 Beta (Abnova H00001388-Q01). Wild-type HEK293T lysate (Origene LY500001 ...
-
No products found
because this supplier's products are not listed.
N Bhaskaran, et al.,
bioRxiv - Immunology 2021
Quote:
... and IL-6 ELISA kits were from Boster Bio (Pleasanton ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus wood particles were decomposed with a mixture (20 mL) of acetic acid containing 1% peracetic acid using a microwave reactor (Biotage Initiator Plus) at 50 ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Harumoto,
bioRxiv - Microbiology 2023
Quote:
... 6 µl GFP-Trap magnetic agarose (ChromoTek, gtmak-20) pre-equilibrated with dilution buffer was added to the diluted lysates ...
-
No products found
because this supplier's products are not listed.
Martin Minařík, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... or a MicroPublisher 6 color CCD camera (Teledyne Photometrics) controlled by Ocular software (Teledyne Photometrics) ...
-
No products found
because this supplier's products are not listed.
Irene Pereira de Sousa, et al.,
bioRxiv - Bioengineering 2019
Quote:
... poly(acrylic acid) 50 kDa (PAA) was purchased from Polyscience Inc ...
-
No products found
because this supplier's products are not listed.
Tianhu Sun, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and LHCB1-6 (Cat#AS01011) antibodies were purchased from Agrisera. A secondary goat-anti-rabbit HRP-conjugated antibody (BioRad cat#1706515 ...
-
No products found
because this supplier's products are not listed.
Leandre M. Glendenning, et al.,
bioRxiv - Immunology 2023
Quote:
Sialic acids were removed from human polyclonal IgG (Innovative Research IHIUGGAP) via recombinant neuraminidase (NEB P0720L ...
-
No products found
because this supplier's products are not listed.
Marcus Deichmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnology, Cat.#21141). Gel imaging was conducted on a Gel Doc XR+ System (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Lydia M Le Page, et al.,
bioRxiv - Immunology 2019
Quote:
... 24μl [1-13C] pyruvate sample (pyruvic acid, 15mM OX63 trityl radical (Oxford Instruments), and 1.5mM Gad-DOTA ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Yifei Cai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... human iPSCs maintained in 6-well-plates were harvested by incubating in Accutase (Innovative Cell Technologies AT104) 1 mL/per well plus 10 µM ROCK inhibitor THX (RI)(Tocris #1254 ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Rasmus Ree, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Couplings were performed using 3-6 equivalents Fmoc-amino acid/TBTU and 6-12 equivalents N-methylmorpholine on the following resin: Tentagel S Trityl resin (RAPP Polymere, Germany), loading ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Megan R. Sayyad, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and non-essential amino acids (0.02mM, Gemini Bio-Products). The mouse mammary carcinoma cell line 4T1 (gift from Dr ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... DMA (Dimethylarsinic Acid Standard Solution, LGC Standards; NIST-3031) and MMA (Monomethylarsonic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Kevin S. Cannon, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Lipidated YxxΦ-cargo peptide (Oleic acid-S{Lys(FITC))}KVTRRPKASDYQRL) was synthesized by Biomatik. HRV3C protease ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...