-
No products found
because this supplier's products are not listed.
Paula Andrea Castañeda Londoño, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 0.25% acryloylaminophenyl boronic acid (Sigma-Aldrich) and 100 mM Tris-acetate (pH 9.0) ...
-
No products found
because this supplier's products are not listed.
Hyunji Yang, et al.,
bioRxiv - Immunology 2023
Quote:
... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
No products found
because this supplier's products are not listed.
Shigeo Takashima, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 14-eicosatrienoic acid (20:3 ω-6, sciadonic acid; Cayman Chemical, # 10009999), all cis-8 ...
-
No products found
because this supplier's products are not listed.
Yuto Hasegawa, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 10 μM 6-Imino-3-(4-methoxyphenyl)-1(6H)-pyridazinebutanoic acid hydrobromide (SR95531; GABAA receptor antagonist, all from Tocris). The resting membrane potential was measured after whole-cell configuration was achieved ...
-
No products found
because this supplier's products are not listed.
Clément M Potel, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Silica beads functionalized with phenyl-boronic acid (Bondesil-PBA 40µm, Agilent) were used for glycopeptides enrichment at an optimized ratio of 1:2.5 sample:PBA beads w/w ...
-
No products found
because this supplier's products are not listed.
Ethan W. Morgan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Indole-3-propionic acid and indole-3-lactic acid were from Alfa Aesar (Heysham, UK). AIN93G was purchased from Dyets ...
-
No products found
because this supplier's products are not listed.
Gina K. Thomson, et al.,
bioRxiv - Microbiology 2019
Quote:
... Solution B comprised 30 μl of solution A supplemented with 2 μl of a solution prepared by dissolving 120 mg of phenyl boronic acid in 3 ml dimethyl sulfoxide (VWR International catalog # BDH1115-1LP) and adding this to 3 ml sterile inoculum water (Beckman Coulter ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Shigeo Takashima, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 19-docosahexaenoic acid (22:6 ω-3, DHA, Tokyo Chemical Industry/TCI, Tokyo, Japan, #D2226). The FA standards were dissolved in a solution containing two volumes of chloroform and one volume of methanol with 0.05% (w/v ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Anastasia Yunusova, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
No products found
because this supplier's products are not listed.
Niels Frimodt-Møller, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 μL S30 premix without amino acids (Promega), plus water to a final reaction volume of 15 μL were incubated for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Alexander I. Hsu, Eric A. Yttri,
bioRxiv - Neuroscience 2021
Quote:
... adult C57BL/6 mice (3 females, Jackson Laboratory). The single brown mouse shown in Figure 2a ...
-
No products found
because this supplier's products are not listed.
Opeyemi Ernest Oludada, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
No products found
because this supplier's products are not listed.
Lea Reuter, et al.,
bioRxiv - Plant Biology 2021
Quote:
... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Rashmi Dash, et al.,
bioRxiv - Microbiology 2023
Quote:
... Venous blood was collected in 6 mL vacutainer tubes (acid dextrose solution anticoagulant; BD India) from all the smear positive patients for Plasmodium vivax mono infection with signed informed consent between the age of 12 months to 65 years between 2013 to 2019 ...
-
No products found
because this supplier's products are not listed.
Kehui Xiang, David P. Bartel,
bioRxiv - Molecular Biology 2021
Quote:
... indole-3-acetic acid (IAA, GoldBio) was dissolved in ethanol and added to cells at a concentration of 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Sandip M. Swain, Rodger A. Liddle,
bioRxiv - Cell Biology 2020
Quote:
... 6-eicosatrienoic acid (Santa Cruz Biotechnology; sc-221066), arachidonic acid (Sigma ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... fixed in Methacarn (1/3/6 mixture of acetic acid/chloroform/methanol) overnight at room temperature and stained with carmine alum (Stem Cell Technologies), or fixed in 4% paraformaldehyde overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Jessica Brown, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Four μg of Tau12 (N-terminal [epitope = amino acids 6-18], BioLegend), HT7 (mid-region [epitope = amino acids 159-163] ...
-
No products found
because this supplier's products are not listed.
Ryan Hull, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Gang Ye, et al.,
bioRxiv - Microbiology 2020
Quote:
Male C57BL/6 mice (3 to 4 weeks old) (Envigo) were intravenously injected (tail-vein ...
-
No products found
because this supplier's products are not listed.
Caitriona M. McEvoy, et al.,
bioRxiv - Immunology 2021
Quote:
Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
No products found
because this supplier's products are not listed.
Itika Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3 mg total protein was loaded on a Superose 6 HR10/30 (GE Healthcare) column equilibrated with PBS ...
-
No products found
because this supplier's products are not listed.
Jelena Platisa, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Pipettes were pulled from thin-walled borosilicate capillaries without filament (3-6 MΩ) (Sutter Instruments), and filled with internal solution containing (in mM ...
-
No products found
because this supplier's products are not listed.
Craig McElroy, et al.,
bioRxiv - Biochemistry 2023
Quote:
... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
No products found
because this supplier's products are not listed.
Michelle K. Cahill, et al.,
bioRxiv - Neuroscience 2023
Quote:
... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Patarasuda Chaisupa, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Deuterated indole-3-acetic acid (d7-IAA, Cambridge Isotope Laboratories) was used as an internal standard at a concentration of 75 nM in all samples and standards ...
-
No products found
because this supplier's products are not listed.
Paula I Seoane, et al.,
bioRxiv - Microbiology 2019
Quote:
... polyinosinic-polycytidilic acid (polyIC) at 3 and 30 ng/mL (Invivogen), type-I interferon receptor inhibitor (IFNARinh ...
-
No products found
because this supplier's products are not listed.
Cheryl E. G. Leyns, et al.,
bioRxiv - Neuroscience 2022
Quote:
... antigen retrieval was performed by using either formic acid for 5 minutes at room temperature or citric acid pH=6 (Vector Laboratories; Cat# H-3300) for 15 minutes at 95 °C ...
-
No products found
because this supplier's products are not listed.
Matthew Denholtz, et al.,
bioRxiv - Genomics 2019
Quote:
... cells were washed 3×3 minute in PBS and fixed for 30 minutes in 6% paraformaldehyde (Electron Microscopy Sciences 15710) in 1x PBS ...
-
Cat# HY-B0236-50 mg,
50 mg, USD $66.0
Ask
Pooja Khanna, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3-bromopyruvic acid (MedChemExpress, HY-19992) was diluted in DMSO and cells were treated at the indicated concentrations ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Natasja L. de Vries, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µg/mL anti-ULBP2/5/6 (clone 165903, R&D Systems), and 6 µg/mL anti-ULBP3 (clone 166510 ...
-
No products found
because this supplier's products are not listed.
M. Dolores Martin-de-Saavedra, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and kynurenic acid 1 for 2-3 min and then glued on a vibratome VT1000S (Leica). The slicing chamber was filled with the same ice-cold aCSF ...
-
No products found
because this supplier's products are not listed.
Amédée Renand, et al.,
bioRxiv - Immunology 2020
Quote:
... sequences [SLA (p1-p53)] or 0.6 nmol/mL PepTivatorR Candida albicans MP65 (peptides pools of 15 amino acids length with 11 amino acid overlap, Miltenyi Biotec) in 5% human serum RPMI medium in the presence of 1µg/ml anti-CD40 (HB14 ...
-
No products found
because this supplier's products are not listed.
Chen Farhy, et al.,
bioRxiv - Cell Biology 2019
Quote:
GBM2 cells were plated at 2000 cells/well and exposed to Prestwick compounds (3 µM; Table 6) for 3 days in 384-well optical bottom assay plates (PerkinElmer). Cells were then fixed and stained with rabbit polyclonal anti-H3K27ac and mouse monoclonal anti-H3K27me3 antibodies followed by AlexaFluor-488- or AlexaFluor-555-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
James A. D’Amour, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes of 4-6 MOhm resistance (borosilicate glass, World Precision Instruments, no. TW150F-3) were prepared on Narishige (PP-830 ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Vikas D. Trivedi, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... OD600 measurement was checked at frequent time intervals (3-6 h) on SpectraMax M3 spectrophotometer (Molecular Devices). Growth rate was determined by plotting the values in GraphPad Prism following non-linear regression and using exponential growth equation ...
-
No products found
because this supplier's products are not listed.
Rachel Thomas, et al.,
bioRxiv - Neuroscience 2021
Quote:
... okadaic acid (Cell Signaling): 0.2 or 1 µM ...
-
No products found
because this supplier's products are not listed.
Huiwang Zhan, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 400mM 3-Bromopyruvic acid (BioVision, #B1045), 20 mM MitoTracker (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Dušan Veličković, et al.,
bioRxiv - Biochemistry 2023
Quote:
... placed onto double-sided adhesive copper tape (3-6-1182; 3M United States) adhered to indium tin oxide-coated glass slides (Bruker Daltonics ...
-
No products found
because this supplier's products are not listed.
Eric T. Hall, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...