-
No products found
because this supplier's products are not listed.
Diana N. Medina-Pérez, et al.,
bioRxiv - Microbiology 2020
Quote:
... B burgdorferi strains were grown in BSK-II media supplemented with 6% normal rabbit serum (Pel-Freez Biologicals, Rogers, AR) under conventional microaerobic conditions at 32°C ...
-
No products found
because this supplier's products are not listed.
Umed Boltaev, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and immunostained for 2h at room temperature with anti-5HT2a antibodies from Immunostar (1/200 dilution ...
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
PRG-3 and Attachment Factor™ are engineered to work together to stabilize the cell membrane and...
Cat# 4Z0-410,
100.0 mL, $82.0
Ask
Jessica Migliavacca, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... coated overnight with 0.07 μg/μl collagen I (5005-B, Cell systems) diluted in 70% EtOH ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Patricia A Blundell, et al.,
bioRxiv - Immunology 2019
Quote:
Native influenza B Hong-Kong 5/72 was obtained from Meridian Life Sciences. To determine the optimal virus-to-erythrocyte ratio ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Quantitative analysis of the CFTR B and C-bands was performed using Compass software (Protein Simple).
-
No products found
because this supplier's products are not listed.
Sebastian Jusuf, et al.,
bioRxiv - Microbiology 2020
Quote:
... GBS (ATCC 12386) was grown in New Granada Media/Strep B Carrot Broth (Z40, Hardy Diagnostics) at 37°C for 48 to 72 hours until the broth turned a rich orange-red color ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Ward Vleeshouwers, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were plated one day prior to measurements or transfection in Willco dishes (Willco Wells BV) at 400.000 cells/dish or in 96 well-plate (microplate BD Falcon ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Phillip Nußbaum, et al.,
bioRxiv - Microbiology 2020
Quote:
... One ml of the nutrition pad solution was poured in a round Delta T Dish (Bioptechs Inc.). After the pad had solidified 3 µl of cells in very early exponential phase (OD600 0.05-0.1 ...
-
No products found
because this supplier's products are not listed.
Marina Barba-Aliaga, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and mixed with one volume of glass beads for further homogenization in a Precellys tissue homogenizer (Bertin Corp.). Lysates were cleared by centrifugation at 12000 rpm for 5 min at 4°C and protein extracts were assayed for firefly and Renilla luciferase activity sequentially in a 96-well luminometry plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Kavya Prasad, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mounted in Vectashield Antifade solution (4’,6 diamidino-2-phenylindole, Vector laboratories H-1200, Axxora/Alexis, Lörrach, Germany) with DAPI and cover with 24×60 mm coverslip sealed with a nail polish ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
Riley A. Suhar, et al.,
bioRxiv - Bioengineering 2021
Quote:
... for HA-B or Ald- CH2-PEG3-Azide (BroadPharm, BP-21715) for HA-A in extra-dry DMSO (100 mg mL-1 ...
-
No products found
because this supplier's products are not listed.
John DeSisto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... FGF and PDGF A/B at 20 ng/μL (Shenandoah Biotechnology). Cells were passaged as required by trituration to break up the neurospheres and replacement of the medium.
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Richard M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 6% defibrinated sheep blood (HemoStat Laboratories) and grown at 37°C for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Esther Martínez-Martínez, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and B (0.5% acetic acid in 80% acetonitrile; LGC Standards-Promochem, Wesel, Germany) with increasing organic proportion was used for peptide separation ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Maja Gehre, et al.,
bioRxiv - Genetics 2019
Quote:
... Lysis buffer was prepared by diluting one part direct-lysis reagent (301-C, Viagen Biotech) in two parts destilled water (e.g ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Ramona Haji-Seyed-Javadi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
ChIP assay was performed using ChromaFlashTM One-Step ChIP Kit (P-2025, Epigentek, Farmingdale, NY, USA) according to the manufacture’s instruction ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Yvan M. Vachez, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were individually placed in a 30cm x 20cm behavioral arena (Lab Products Rat One Cage 2100™) and given 60 min/day to consume a highly palatable liquid (Nesquik® ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Qi Wang, et al.,
bioRxiv - Genomics 2023
Quote:
... and RNasin Plus (Promega)] 10-15 times using pestle A “loose” followed by pestle B “tight” 10-15 times (DWK Life Sciences, Millville, NJ, USA). Homogenate was passed through a 70 µm 1.5 ml mini strainer (PluriSelect ...
-
No products found
because this supplier's products are not listed.
Mary Kefi, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... After validation of recombinant protein expression of expected size in Sf9 cells and determination of viral stock titers using baculoQUANT ALL-IN-ONE (GenWay), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jixing Li, Marco Lai, Liina Pylkkänen,
bioRxiv - Neuroscience 2023
Quote:
... This task differed from the prior minimal composition studies which have only used one matching or mismatching task picture (Bemis & Pylkkanen, 2011). The reason for our larger set of pictures was that this decreased the chance of an accurate response by chance ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
José R Pittaluga, et al.,
bioRxiv - Immunology 2024
Quote:
... A PVP-free polycarbonate membrane (3 µm pore size; Neuro Probe Inc. Gaithersburg MD, USA) separated cells from lower wells containing either RPMI or the stimulus (pRNA or CM) ...
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
Anti-RNP was detected in female 52 week old C57Bl/6 and 32-52 week old NZM2328 mice (harvested at time of nephritis or at 52 weeks) via ELISA (Alpha Diagnostics, San Antonio, TX) according to manufacturer’s instructions.