-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Dakota R. Robarts, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and GenX (Synquest Laboratories cat # 2122-3-09, lot # 00008887) were dissolved in 0.5% Tween-20 at final concentrations of 0.067 g/L ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Hannah M. Starnes, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... PFOS (CAS 2795-39-3, purity ≥ 98%) was from Matrix Scientific (Columbia, SC), and 1H,1H,2H,2H-perfluorooctanol (6:2 FTOH ...
-
No products found
because this supplier's products are not listed.
Aritra Nath Kundu, et al.,
bioRxiv - Bioengineering 2023
Quote:
... for 3 hours at room temperature in a peptide synthesis vessel (ChemGlass, Vineland, NJ). The peptide solution was filtered to remove the resin and the peptide was precipitated out using diethyl ether at -80°C ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Lucy Chou-Zheng, Asma Hatoum-Aslan,
bioRxiv - Microbiology 2019
Quote:
... The most concentrated fractions (3 ml total) were pooled and mixed with SUMO Protease (MCLAB, CA, USA) and provided SUMO buffer (salt-free) ...
-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
Carbohydrate
Cat# GOS0108S,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
Manuel García-Jaramillo, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... and their precursor dopamine were measured in fish (n=12) using the 3-CAT ELISA (Rocky Mountain Diagnostics, Inc., Colorado Springs, CO) per manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Kevin J Pridham, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... containing 3% fetal bovine serum (Peak Serum, Inc.), 10 X G-5 Supplement (Gibco) ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... mounted on B3-3 magnetic bases (Mitegen, GB-B3-R). MicroRT tubing (Mitegen ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Clara J. Amorosi, et al.,
bioRxiv - Genomics 2021
Quote:
... Hex-5-yn-1-amine was purchased from GFS Chemicals (Powell, OH).
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
No products found
because this supplier's products are not listed.
Ana Carolina A. L. Campos, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and Fe supplied as 10μM Fe-HBED N,N’-di(2-hydroxybenzyl)ethylenediamine-N,N’-diacetic acid monohydrochloride hydrate (Strem Chemicals, Inc., UK). Plant growth trays were rotated every day to help reduce gradient effects of light ...
-
No products found
because this supplier's products are not listed.
Holly Linley, et al.,
bioRxiv - Immunology 2022
Quote:
... placed in 3 µm transwell inserts with 10 µg/ml anti-CD200R1 (OX131, Absolute Antibody), or rat IgG1 isotype control (eBioscience ...
-
No products found
because this supplier's products are not listed.
Cameron L. Woodard, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Pipettes (3-5Ω) were pulled from borosilicate glass capillaries using a micropipette puller (Narishige International). The intracellular solution was cesium-based and contained the following in mM ...
-
No products found
because this supplier's products are not listed.
Xusheng Qiu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) monoclonal antibody was purchased from Meridian Life Science. Horseradish peroxidase (HRP)-conjugated anti-human ...
-
No products found
because this supplier's products are not listed.
Midori Ohta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Renee J. Tamming, et al.,
bioRxiv - Neuroscience 2019
Quote:
Brains from 3-month-old mice were stained using the FD Rapid GolgiStain Kit (FD Neurotechnologies, Inc). They were then flash frozen and sectioned on a cryostat at 100µm thickness and further processed as per kit instructions ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Toshiomi Katsuki, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 30 µg/body 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate labelled HDL (Dil-HDL: KALEN Biomedical, MD, USA) was used ...
-
No products found
because this supplier's products are not listed.
Adrian T. Press, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1,2-Dipalmitoyl-sn-glycerol-3-phosphoethanolamine (DPPE) azide was conjugated to DY-635-alkin (Dyomics GmbH, Jena, Germany) and used to prepare liposomes using a 100 nm extruder ...
-
No products found
because this supplier's products are not listed.
Susan D’Costa, Matthew J. Rich, Brian O. Diekman,
bioRxiv - Bioengineering 2019
Quote:
... with TRIzol™ and homogenized at 6500 rpm × 30 seconds for 3 cycles (Precellys® 24, Bertin Corp). Protein concentration was determined using the Micro BCA Protein assay kit (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
S. Naseeb, et al.,
bioRxiv - Genetics 2021
Quote:
... high-resolution images of phenotypic plates were taken using Phenobooth after 3 days of incubation (Singer Instruments, UK). The colony sizes were calculated in pixels using Phenosuite software (Singer Instruments ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Thomas A. Packard, et al.,
bioRxiv - Cell Biology 2021
Quote:
HLAC cells were stimulated for 3 days with plates coated with 10 µg/mL anti-CD3 (UCHT1, Tonbo Biosciences) and 10 µg/mL anti-CD28 (CD28.2 ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Devon L. Moose, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... The identity of this cell line as a derivative of PC-3 cells was validated by short tandem repeat (STR) analysis (IDEXX). Cells of both the PC-3 and GS689.Li lines were cultured in DMEM/F12 (Gibco ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Tissues were homogenised with 10 pcs of 3 mm Acid-Washed Zirconium Beads (OPS diagnostics Cat# BAWZ 3000-300-23) in a Qiagen TissueLyzer II (30 Hz ...
-
No products found
because this supplier's products are not listed.
Yuki Sato, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... The embryos were embedded in 3% agarose/PBS and subjected to vibratome sectioning into 140-μm-thick sections at 5100 mz (Campden Instruments). The slices were pre-blocked with 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Shanna Romand, et al.,
bioRxiv - Plant Biology 2021
Quote:
... or nitrogen limiting (-N) (+N medium diluted 1/25 in 0.5X Murashige and Skoog medium without nitrogen [Caisson Labs] ...
-
No products found
because this supplier's products are not listed.
Matthieu Fritz, et al.,
bioRxiv - Microbiology 2023
Quote:
... and amplicons approximately 2–3 kb in size were excised from the gel and purified using the Quick-spin PCR Product Purification Kit (iNtRON Biotechnology, Korea). The amplicons were further cloned in pJET1.2 cloning plasmid (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2023
Quote:
... we grew parasites at 37°C in vitro at 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, VA or BioIVT, NY) in RPMI 1640 medium (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Jinchang Zhu, Yi He, Yong Wang, Li-Heng Cai,
bioRxiv - Bioengineering 2023
Quote:
... 4.3 mmol), and hydrazine (13.8 mL, 430.0 mmol) are added to a 60 mL high pressure tube (ACE GLASS, Sigma-Aldrich, Cat. No. Z568872). The tube is sealed ...
-
No products found
because this supplier's products are not listed.
Rui Sun, et al.,
bioRxiv - Systems Biology 2022
Quote:
... and everolimus (Targetmol, 159351-69-6). The cells were then incubated for 72 hrs ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...