-
No products found
because this supplier's products are not listed.
Thomson Patrick Joseph, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... isopropyl β-D-1-thiogalactopyranoside (IPTG) and phenylmethane sulfonyl fluoride were purchased from Tiangen Biotech Co. ...
-
No products found
because this supplier's products are not listed.
Devika Andhare, Michael J Ragusa,
bioRxiv - Biochemistry 2023
Quote:
... Protein expression was induced by adding 1 mM isopropylthio-β-D-galactopyranoside (IPTG; IBI Scientific, IB02125) and the cultures were grown for an additional 18 h at 18°C ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... a N6-Methyl-A-CE phosphoramidite from Glen Research was utilized ...
-
No products found
because this supplier's products are not listed.
Yanwen Fu, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.3% Hydroxypropyl Methyl Cellulose (HPMC) (cat# H1335, Spectrum Chemical), pH 5.8).
-
No products found
because this supplier's products are not listed.
Grace I. Borlee, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 100 nM of 2-chloro-adenosine-5’-O-monophsphate (2-Cl-5’-AMP, Axxora, LLC) for internal standardization ...
-
No products found
because this supplier's products are not listed.
Rahul Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... T7-RILP proteins were expressed in Escherichia coli BL21 (500 μM isopropyl β-d-1-thiogalactopyranoside; Wisent Bioproducts; at room temperature for 16 hours) and purified using standard procedure in tris buffer [20 mM tris (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... and 50 mM HEPES-NaCl (pH 7.4) with 3 mM H-D-isoleucyl-L-prolyl-L-arginine-p-nitroaniline dihydrochloride (Chromogenix S-2288, Diapharma).
-
No products found
because this supplier's products are not listed.
Caitlyn M. Edwards, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma samples were stored at -80°C until acyl-ghrelin was measured using an ELISA kit (BioVendor, R&D; RA394062400R), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
You Wu, Tam L. Ngyuen, Carrie E. Perlman,
bioRxiv - Physiology 2020
Quote:
... surfactant protein D (SP-D; Lifespan Biosciences, Seattle, WA), tumor necrosis factor α (TNF-α ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Stefanie Lübke, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... rabbit anti-β -Gal 1:5000 (Biotrend), rabbit anti-GFP 1:500 (abcam) ...
-
No products found
because this supplier's products are not listed.
Vitaly Polovinkin, et al.,
bioRxiv - Biophysics 2020
Quote:
... solubilisation in β-octyl glucoside (Cube Biotech) and crystallization of BR (from Halobacterium salinarum S9 cells ...
-
No products found
because this supplier's products are not listed.
Arvind M. Korwar, et al.,
bioRxiv - Immunology 2021
Quote:
... and anti-β-actin (Fitzgerald; 1: 25000). Data from three independent experiments were used in densitometric analysis ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Juan A. Perez-Bermejo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
At least 5×107-3×108 Cryopreserved CD34+ HSPCs were then thawed at 37 °C and cultured in supplemented cytokine rich SCGM media (CellGenix) containing recombinant cytokines at 100 ng/mL each Flt-3L ...
-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... 500 μL single-cell suspensions were incubated at 37 °C for 6 h with 5% CO2 in 48-well plates in the presence of Cell Stimulation Cocktail (Tonbo Biosciences, #TNB-4975). Stimulated cells were stained with surface markers as described above ...
-
No products found
because this supplier's products are not listed.
Xiaoxin X. Wang, et al.,
bioRxiv - Pathology 2020
Quote:
... Another cohort of male C57BL/6 mice with the same age were received the same vehicle as above or the STING inhibitor C-176 (Focus Biomolecules, Plymouth Meeting, PA) at a dose of 1mg/kg body weight/day for 3 weeks via intraperitoneal injection.
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Ritesh Tandon, et al.,
bioRxiv - Microbiology 2020
Quote:
... chondroitin sulfate D (CS-D, Mw = 20 kDa) from whale cartilage (Seikagaku, Tokyo, Japan) and chondroitin sulfate E (CS-E ...
-
No products found
because this supplier's products are not listed.
Meng-Hua M. Tsai, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
The recruitment of β-arrestin2 by MOR agonists after G protein activation was assessed using the Cisbio HTRF-based β-arrestin2 recruitment assays (Cisbio Assays, PerkinElmer), which monitored the interaction between β-arrestin2 and AP2 ...
-
No products found
because this supplier's products are not listed.
FREDERICO VIEIRA, Johannes W Kung, Faizah Bhatti,
bioRxiv - Immunology 2020
Quote:
... Sections were then incubated in the following primary antibodies overnight at 4 °C: rabbit polyclonal anti-SP-D (1:100 dilution; Antibodies-online Inc., St. Atlanta, GA, USA); rat anti-CD31 for endothelial cells (1:200 dilution ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Claudia Lancey, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 5 mM β-Mercaptoethanol and 5% Glycerol] containing SUMO protease (LifeSensors) in order to cleave the SUMO tag and generate Pol κ in the native form ...
-
No products found
because this supplier's products are not listed.
Siran Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 150 pmol of 6×His-streptavidin (ProteoGenix) was mixed with 5 μl of sieved beads (10% ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Florian J. Bock, et al.,
bioRxiv - Cell Biology 2020
Quote:
... S63845 (Chemgood, C-1370), Sytox Green (Thermo ...
-
No products found
because this supplier's products are not listed.
Parker W. de Waal, et al.,
bioRxiv - Biophysics 2019
Quote:
... and β-arrestin2 cDNAs were codon-optimized and synthesized by GENEWIZ (Suzhou, China). The site-directed mutations were introduced into μOR (M153A ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 10 ng/mL mrIL-6 (Gemini bio-products). Cells were harvested ...
-
No products found
because this supplier's products are not listed.
Fiona E. Serack, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and incubated in 100 μL D-luciferin (Syd Labs) in PBS at a concentration of 1.25 mg/mL ...
-
No products found
because this supplier's products are not listed.
Junying Zheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... in 6 ml hibernate without calcium (BrainBits, cat. no. HACA) with 15 μl 0.5mM Glutamax ...
-
No products found
because this supplier's products are not listed.
Miguel Ricardo Leung, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-SPACA9 (HPA022243 from Atlas Antibodies, used at 6 μg/mL), or no primary antibody diluted in blocking buffer for 2 h at RT ...
-
No products found
because this supplier's products are not listed.
Galit H. Frydman, et al.,
bioRxiv - Immunology 2019
Quote:
... 10 µL of cells were then imaged on a disposable C-Chip hemocytometer (In Cyto, SKC, Inc. C-Chip) using a 10X and 20X objective on a Nikon TiE fluorescent microscope ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
Charles E. Norton, et al.,
bioRxiv - Physiology 2020
Quote:
... and audible baseline monitor (model ABM-3, WPI) as previously described27 ...
-
No products found
because this supplier's products are not listed.
Sonu Kumar, et al.,
bioRxiv - Microbiology 2020
Quote:
The SEC-purified Fab M4H2K1 and complex were each concentrated to 12 mg/ml before being screened at both 4 °C and 20 °C using our high-throughput CrystalMationTM robotic system (Rigaku) at TSRI (103) ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Terje Wimberger, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Adaptors to the flow system (NanoPort Std 6-32 Coned 1/32, IDEX, USA) were fixed to in- and outlets ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Bevin C. English, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were washed with D-PBS and collected in TRI Reagent (Molecular Research Center). After addition of chloroform ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin (ACTB) (Primerdesign Ltd), using the delta-CT or delta-delta Ct method[38].
-
No products found
because this supplier's products are not listed.
Somnath Shee, et al.,
bioRxiv - Microbiology 2022
Quote:
... at 37°C with rolling at 6 RPM in a roller incubator (120 Vac Roll-In Incubator; Wheaton, Millville, NJ). Cultures grown to OD600 ≈ 0.2 were harvested by centrifugation (4000 g for 5 min ...
-
No products found
because this supplier's products are not listed.
Leonard Yoon, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and Tubulin β-III (Tuj1) (Neuromics) at 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
Dian Kortleve, et al.,
bioRxiv - Immunology 2024
Quote:
... 6% human serum (Sanquin, Amsterdam, the Netherlands), 200 mM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Yoko Miura, et al.,
bioRxiv - Pathology 2021
Quote:
... rabbit anti-SP-C (Hycult Biotech), rat anti-Podoplanin (MBL) ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and incubated at 37°C and 5% CO2 (Nuaire, DH Autoflow). Media was changed every 48 hours and cells passaged when they reached confluence as recommended by the supplier ...