-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
No products found
because this supplier's products are not listed.
Adva Mechaly, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
No products found
because this supplier's products are not listed.
Bhairavi Tolani, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
No products found
because this supplier's products are not listed.
Jessica L Hoffman, et al.,
bioRxiv - Neuroscience 2022
Quote:
5-[2-Chloro-6-(trifluoromethoxy)phenyl]-1,3-dihydro-2H-benzimidazol-2-one (JNJ-5; Tocris, Minneapolis, MN) is a high affinity ...
-
No products found
because this supplier's products are not listed.
Emily C. Britt, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2-chloro-4,5-difluoro-N-[[[2-methoxy-5-[[(methylamino)carbonyl]amino]phenyl]amino] carbonyl]-benzamide (Cayman Chemical, no. 17578) were used ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Samir Jana, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5-bromo-4-chloro-3-indoxylphosphate/nitroblue tetrazolium chloride (BCIP/NBT) substrate (Abcam cat # ab7468).
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
No products found
because this supplier's products are not listed.
Justin E. Silpe, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
T.A. Hartjes, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG-DSPE, Avanti Polar Lipids) were dissolved in ethanol in a molar ratio of 53:42:5 to a final concentration of 10 mM total lipid (Batch 1 ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Anne D. Villela, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
No products found
because this supplier's products are not listed.
Christopher Douglas, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Cody M. Rogers, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
No products found
because this supplier's products are not listed.
Mahebali Tabusi, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 male C57BL/6 wild-type mice 5 to 6 weeks old (Charles River) per experimental group were used that were anesthetized by inhalation of isofluorane (Abbott ...
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 100 μg/mL 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal, VWR), or with 0.1 μM CdCl2 (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Chisato M. Yamazaki, et al.,
bioRxiv - Bioengineering 2020
Quote:
Female BALB/cJ mice (5−6 weeks old, n = 3 per group, The Jackson Laboratory, Stock No: 000651) received a single dose of the MMAE/F 4+2 dual-drug ADC (20 or 40 mg kg−1) ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Natasja L. de Vries, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µg/mL anti-ULBP2/5/6 (clone 165903, R&D Systems), and 6 µg/mL anti-ULBP3 (clone 166510 ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
Katarzyna Wacnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 µl of 1 M NaOH and 6 µl of Cell-Tak (Corning, 5% (w/v) in acetic acid ...
-
No products found
because this supplier's products are not listed.
Zackary Sabetta, et al.,
bioRxiv - Neuroscience 2023
Quote:
A total of 64 young adult age-matched male and naturally cycling female Sprague-Dawley rats (~3 months old; males 367 ± 3 g and females 235 ± 1.5 g; n = 5-6/group; Envigo, Indianapolis, IN, USA) were used in these experiments and maintained in a 12:12 h light:dark cycle in a temperature and humidity-controlled room ...
-
No products found
because this supplier's products are not listed.
Masahito Yamagata, Wenjun Yan, Joshua R. Sanes,
bioRxiv - Neuroscience 2020
Quote:
... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
No products found
because this supplier's products are not listed.
Claire C. Chen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cell viability was determined using the 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxyanilide inner salt (XTT) assay according to the manufacturer’s protocol (Biotium). The assay utilizes the ability of viable cells with active metabolism to reduce the yellow tetrazolium salt to the soluble orange formazan product by mitochondrial dehydrogenase enzymes ...
-
No products found
because this supplier's products are not listed.
Tomas Kouba, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For labeling pCp-Cy5 (Cytidine-5’-phosphate-3’-(6-aminohexyl)phosphate (Jena bioscience), was ligated to the 3’ end of the 16 nt RNA using T4 RNA ligase (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Andrea Tagliani, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Yun Deng, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... with 5-bromo-4-chloro-3-indolyl-phosphate nitro blue tetrazolium staining (Vector Laboratories, Burlingame, CA, USA). 10 ∼ 30 embryos were used for each probe ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Sangin Kim, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5-chloro-2ʹ-deoxyuridine (CldU) (#105478) (MP Biomedicals); Shield1 (632189 ...
-
No products found
because this supplier's products are not listed.
Aidan B Estelle, et al.,
bioRxiv - Biophysics 2023
Quote:
... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
No products found
because this supplier's products are not listed.
Kazuki Nagata, et al.,
bioRxiv - Immunology 2023
Quote:
BMMCs were generated from the BM cells of C57BL/6 mice (Japan SLC, Hamamatsu, Japan) by cultivation in the presence of 5 ng/mL of mouse IL-3 (BioLegend) as previously described 18 ...
-
No products found
because this supplier's products are not listed.
Caitriona M. McEvoy, et al.,
bioRxiv - Immunology 2021
Quote:
Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
Haotian Zhang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... recombinant mouse Interleukin-3 (6 ng/ml) and recombinant human Interleukin-6 (10 ng/ml) (all from Stem Cell Technologies). 200ul fresh SFEM medium with cytokines was added on Day 5 and 8 and cells were counted on Day 5 and 10.
-
No products found
because this supplier's products are not listed.
Chunmei Li, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... stained in 1mg/ml 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal, Cell Signaling) pH of 5.9-6.1 overnight at 37C ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Patricia Bilodeau, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5’-ATAAGCTCCCTGCCCGAGTC-3’ (Santa Cruz sc-430739).
-
No products found
because this supplier's products are not listed.
Mai Takenaka, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... riluzole (supply name: 2-amino-6-(trifluoromethyl)benzothiazole) and 4-chloro-3-ethylphenol (4-CEP) from Tokyo Chemical Industry (Tokyo, Japan), and 4-chloro-m-cresol (4-CMC ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
James A. D’Amour, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Electrodes of 4-6 MOhm resistance (borosilicate glass, World Precision Instruments, no. TW150F-3) were prepared on Narishige (PP-830 ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Thivanka Muthumalage, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and 6 hours using microplate spectrophotometer (Cytation 5, Biotek).