-
No products found
because this supplier's products are not listed.
Hailong Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
JAK inhibitors pyridine-6 (BioVision, Cat No. 2534) and ruxolitinib (NCB018424 ...
-
No products found
because this supplier's products are not listed.
Rachel L. Edwards, et al.,
bioRxiv - Microbiology 2019
Quote:
... Luna-NH2 column (3 μm, 150 × 2 mm, Phenomenex) was used flowing at 0.4 mL/min ...
-
No products found
because this supplier's products are not listed.
Katharina Best, et al.,
bioRxiv - Biochemistry 2022
Quote:
... R3/3 copper grids with a 2 nm carbon coating (Quantifoil) using a Vitrobot mark IV (FEI ...
-
No products found
because this supplier's products are not listed.
Yili Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Intracellular recordings from MNs were made with 10-20 MΩ sharp electrodes filled with 3 M potassium acetate connected to an Axoclamp 2-B amplifier (Molecular Devices). Data acquisition and analyses of resting potential ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Faten A. Sayed, et al.,
bioRxiv - Neuroscience 2020
Quote:
... incubated with 3% collagenase type 3 (Worthington), 3 U/ml dispase (Worthington ...
-
No products found
because this supplier's products are not listed.
Samuel S.H. Weng, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and plasma and bone marrow interstitial fluid samples from three pediatric B-ALL patients (B-ALL-1, −2, −3) were processed on an epMotion M5073 automated liquid handling system (Eppendorf) controlled by an EasyCon tablet (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Fanny Georgi, et al.,
bioRxiv - Microbiology 2020
Quote:
... 3’-deoxy-3’-fluorothymidine (DFT, CAS number 25526-93-6) was obtained from Toronto Research Chemical, North York ...
-
No products found
because this supplier's products are not listed.
Gang Ye, et al.,
bioRxiv - Microbiology 2020
Quote:
Male C57BL/6 mice (3 to 4 weeks old) (Envigo) were intravenously injected (tail-vein ...
-
No products found
because this supplier's products are not listed.
Raisa I. Krutilina, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Ester Orav, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Sections were washed 3 x 10 min in PBS and incubated 1h with blocking solution containing 10% normal goat serum (NGS, MP Biomedicals, USA), 3% BSA in PBST ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Zhaoduan Liang, et al.,
bioRxiv - Immunology 2019
Quote:
... 5-Bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium (BCIP/NBT, Mabtech) was used to develop the immune-spot according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Vignesh Venkatakrishnan, et al.,
bioRxiv - Biochemistry 2020
Quote:
... disrupted with a tip sonicator at 1/3 power (8 MHz) for 3 × 30 seconds on ice and fractionated by ultracentrifugation (100’000 x g, 1H, Beckman TLA 120.2 rotor). The luminal fraction was concentrated to around 50 µL on a 3 kDa MWCO Amicon Ultra 0.5 mL centrifugal filter while membrane pellets were dissolved in 50 µL TBS with 2% SDS ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Julianna L. Sun, et al.,
bioRxiv - Microbiology 2022
Quote:
... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001. Images were captured using a Nikon Z1000 microscope.
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Joaquín Miguel Pellegrini, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were then incubated with mouse anti-human LC3A/B antibody (MBL International, M152-3) for 20 min ...
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Richard B Crouse, et al.,
bioRxiv - Neuroscience 2020
Quote:
... blocked for 2-3 hours (0.3% Triton X-100, American Bioanalytical, Canton, MA; 3% normal donkey serum, Jackson ImmunoResearch, West Grove, PA), then incubated overnight with primary antibodies (1:1000 + 1% normal donkey serum) ...
-
Building Block
Sold for research purposes only.
Cat# 2592.0, SKU# 2592-1000 mg,
1000mg, US $165.00 / EA, EURO, €150 / EA
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Tim Nierhaus, et al.,
bioRxiv - Microbiology 2021
Quote:
... pooled and concentrated to 2-3 mg/ml using Vivaspin 15R concentrators (2 kDa MWCO HY, Sartorius). Small aliquots were flash-frozen in liquid nitrogen and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Rachael Gordon, et al.,
bioRxiv - Immunology 2019
Quote:
... were detected with bromo-4-chloro-3-indolyl phosphate substrate (Southern Biotech).
-
No products found
because this supplier's products are not listed.
Hamza A. A. Elati, et al.,
bioRxiv - Microbiology 2023
Quote:
... 2’,3’-dideoxyuridine was from Carbosynth; Pyrimethamine was from Fluka ...
-
No products found
because this supplier's products are not listed.
Morgan E. Mouchka, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... Colonies were screened on LB plates with 50 μg/mL ampicillin and 9.5 mg/mL X-gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; APExBIO) and Sanger sequencing of the J was used to confirm cloning and successful transformation of the ancestral λ sequence.
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Hiroshi Ichise, et al.,
bioRxiv - Immunology 2021
Quote:
... BA685RIF‐3 (Olympus), two dichroic mirrors ...
-
No products found
because this supplier's products are not listed.
Ashwathi Rajeevan, Riya Keshri, Sachin Kotak,
bioRxiv - Cell Biology 2020
Quote:
Double-stranded siRNA oligonucleotides used were 5’- CAGUACCAGUGAGUGGCCCCACCUG-3’ (NuMA 3’UTR siRNA; Eurogentec) and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
... VAMP1/2/3 (104102) were purchased from Synaptic Systems. Antibody against actin (AC-15 ...
-
No products found
because this supplier's products are not listed.
Walden Li, Ryan M. Wyllie, Paul A. Jensen,
bioRxiv - Microbiology 2020
Quote:
... Strains carrying the pLacZ plasmid appear blue when plated on 0.008% X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Zymo Research, CA, USA). X-gal concentrations above 0.008% appear to inhibit growth of S ...
-
No products found
because this supplier's products are not listed.
Tingting Li, et al.,
bioRxiv - Immunology 2021
Quote:
... The gradient concentrations of SARS-CoV-2 S1 or an artificial chimeric construct carrying 3 mutations on B.1.351 RBD and SD614G (B.1.351 S1) (Sino Biological, Beijing, China) were prepared (2-fold dilutions ...
-
No products found
because this supplier's products are not listed.
Moritz Gerster, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and segmented “1–3–3–1” electrode DBS-LFP (Abbott St ...
-
No products found
because this supplier's products are not listed.
Soshi Noshita, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×104 cells were seeded into 2-well silicone culture insert (ib80209, ibidi) in a 35 mm dish and cultured overnight ...
-
No products found
because this supplier's products are not listed.
Samantha Sarni, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The following day they were transfected with 6 μg Gag plasmid + 6 μg vector plasmid + 3 μg pCMV-Rev (to support nuclear export of vector RNA) using Transit-293 (Mirus) following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Emily Maguire, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Designated wells were inhibited by pre exposure for 2 hours with 3-a-aminocholestane (20µM, B-0341), LY294002 (10µM, B-0294) or SF1670 (5µM, B-0350) (Echelon Bioscience). Cells were then exposed to ice cold 0.5 M TCA (Trichloroacetic acid T6399 Sigma ...
-
No products found
because this supplier's products are not listed.
Anindya Ganguly, et al.,
bioRxiv - Plant Biology 2019
Quote:
... 4-day-old light-grown seedlings were incubated with either 20 µM oryzalin (Supelco Analytical) for 3 h or 2 µM latrunculin B (Enzo Life Science) for 2 h before imaging.
-
No products found
because this supplier's products are not listed.
Esmeralda Vásquez Pacheco, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 × 105 cells were seeded per well in 6-well plates (Greiner Bio-One). The following day ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Oskar Staufer, et al.,
bioRxiv - Immunology 2022
Quote:
... cells were stained with anti-human ICAM-1-AlexaFluor647 (BioXcell, BE0020-2, 3 µM), anti-human CD58-AlexaFluor647 (BD Bioscience ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...
-
No products found
because this supplier's products are not listed.
Ryann M. Fame, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5–10 μL of CSF or serum was extracted in 4:6:3 chloroform:methanol:water mixture supplemented with isotopically labeled T3 and T4 (at 100 nM, Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Rowena Hill, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... 2–5.5 µg of each sample was sheared using the Megaruptor 3 instrument (Diagenode, Liege, Belgium) at 18-20ng/µl and speed setting 31 ...
-
No products found
because this supplier's products are not listed.
Brianna E. Alexander, Huaning Zhao, Sophie Astrof,
bioRxiv - Developmental Biology 2023
Quote:
... and Cyanine 3 (Akoya Bioscience, NEL744001KT) according to manufacturer protocols ...
-
No products found
because this supplier's products are not listed.
Thomas I. R. Hopkins, et al.,
bioRxiv - Biophysics 2021
Quote:
... 100% (3 × 1h)) and then placed in Histoclear (Cat. No HS-200, National Diagnostics) overnight ...
-
No products found
because this supplier's products are not listed.
Erin E. Henninger, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3×30 seconds at 6 M/s and zirconium/silica beads (BioSpec Products 11079105z). Next ...
-
No products found
because this supplier's products are not listed.
Seraphine Kamayirese, et al.,
bioRxiv - Biochemistry 2023
Quote:
(His)6-14-3-3ε was commercially obtained from Novus Biologicals (Centennial CO, USA), and 14-3-3ε-(His)12 was expressed in our laboratory (see details on protein expression in the supporting information) ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...