-
No products found
because this supplier's products are not listed.
Dali Zong, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and incubated with a commercially available Cy3-labeled (CCCTAA)3 peptide nucleic acid probe (PNA Bio) recognizing mammalian telomere sequences ...
-
No products found
because this supplier's products are not listed.
Yuuki Wittmer, et al.,
bioRxiv - Biophysics 2022
Quote:
... ∼6 mL using Millipore Amicon Ultra-15 3 kDa MWCO centrifugal filter and dialyzed (Spectrum Laboratories 1.7 ml/cm standard SpectraPor 1 RC Tubing ...
-
No products found
because this supplier's products are not listed.
Nina Sillner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cholic acid 7-sulfate (CA-S) and 3’-sialyllactose were purchased from Cayman (Biomol GmbH, Hamburg, Germany). Sulfate (S ...
-
No products found
because this supplier's products are not listed.
AJ Brandner, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... a set of eight monofilaments at logarithmic intervals from 0.008 to 6 grams (0.008, 0.023, 0.07, 0.16, 0.4, 1, 2, and 6 grams; Stoelting, Wood Dale, IL) were applied to the center of the plantar surface of the left hind paw for up to 4 seconds using the up–down method (Chaplan et al. ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, et al.,
bioRxiv - Biophysics 2023
Quote:
... pH 6) and 1 μL of Silver Bullets (Hampton Research) reagent [G3 (0.25% 2,2’-Thiodiglycolic acid ...
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2022
Quote:
... DNA amplifications for the conTRT amplicons were performed similarly except Ranger DNA polymerase (1×10-6 approximate error/bp) from Bioline was utilized ...
-
No products found
because this supplier's products are not listed.
Tamar Frankovits, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, James A. Van Deventer,
bioRxiv - Synthetic Biology 2021
Quote:
... (S)-2-amino-6-(((prop-2-yn-1-yloxy)carbonyl)amino)hexanoic acid (AstaTech), Nε-Boc-L-lysine (Chem-Impex International) ...
-
No products found
because this supplier's products are not listed.
Meitham Amereh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Citric acid monohydrate (CAS# 5949-29-1) and sodium citrate (CAS# 6132-04-3) from Bio basic Canada Inc ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Steven R. Talbot, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the cecum was 2/3 ligated (Nylon Monofilament Suture 6/0, Fine Science Tools GmbH, Heidelberg, Germany) distal to the ileocecal valve ...
-
No products found
because this supplier's products are not listed.
Gema M. Olivarria, et al.,
bioRxiv - Microbiology 2021
Quote:
... Mac2/ Galactin-3 (1:500, CL8942AP Cedarlane), CD4 (1:200 Abcam) ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Huntly M. Morrison, et al.,
bioRxiv - Immunology 2022
Quote:
Peptides were resuspended in 0.1% formic acid and 3% directly injected on a 75 μm ID column (New Objective) packed with 25 cm of Reprosil C18 3 μm ...
-
No products found
because this supplier's products are not listed.
VG LeBlanc, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1-100 ng of total nucleic acid was sonicated (Covaris LE220) in 62 µL volume to 250-350 bp ...
-
No products found
because this supplier's products are not listed.
SAKIRUL I KHAN, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and rabbit polyclonal anti-caspase 3 (1:1000; Bioss) plus mouse monoclonal anti-CB (1:1000 ...
-
No products found
because this supplier's products are not listed.
Melis D. Arslanhan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti Centrin-3 (1:1000, Abnova, H8141-3EG), mouse anti V5 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Kristen Mehalko, et al.,
bioRxiv - Genetics 2022
Quote:
... The tissue was homogenized using a BeadBug 6 microtube homogenizer for 3 rounds of 30 seconds at 3000 rpm (Benchmark Scientific, 422V16). RNA was purified from homogenized tissue using the Direct-Zol RNA Miniprep kit (Zymo Research ...
-
No products found
because this supplier's products are not listed.
Teng-Chieh Yang,
bioRxiv - Bioengineering 2023
Quote:
... One (1) μm yellow PSP and 6 μm red PSP were from Polyscience Inc ...
-
No products found
because this supplier's products are not listed.
Sonali Gupta, et al.,
bioRxiv - Systems Biology 2020
Quote:
... The amino acid solutions consisted of either EZ Amino Acids (AA, Teknova) or a modified amino acid solution (AA* ...
-
No products found
because this supplier's products are not listed.
Rebecca L. Pinals, et al.,
bioRxiv - Bioengineering 2019
Quote:
... Solutions were probe-tip sonicated for 10 minutes in an ice bath (3 mm probe tip set at 50% amplitude, 5-6 W, Cole-Parmer Ultrasonic Processor). Samples were centrifuged to pellet insoluble SWCNT bundles and contaminants (16,100 cfg for 30 minutes) ...
-
No products found
because this supplier's products are not listed.
Nina Sillner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... glycocholic acid (GCA) and taurocholic acid (TCA) were purchased from Steraloids (Newport, RI, USA). Cholic acid 7-sulfate (CA-S ...
-
No products found
because this supplier's products are not listed.
Eric M. Mulhall, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica microspheres (200 μL of 1% w/v, 3 μM; Bangs Laboratories) were cleaned and hydroxylated by first washing them in a glass tube in MilliQ water ...
-
No products found
because this supplier's products are not listed.
Jennifer O’Brien, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and chicken anti-beta-tubulin 3 (Aves Labs, TUJ-0020, 1:500).
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The WPRE 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
No products found
because this supplier's products are not listed.
Jennifer A. Rinker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were deeply anesthetized with vaporized isoflurane (1-3%, SomnoSuite Vaporizer, Kent Scientific) and 200 nl of AAV1-CaMKII-GCaMP6f (Addgene ...
-
No products found
because this supplier's products are not listed.
Shuting Cao, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... The Control diet (A11112201) contained all essential amino acids and nonessential amino acids as specified by Research Diets. Glutamine-supplemented diet contained all amino acids equal to the control diet with the addition of 200 g of glutamine by Ishak Gabra [43] ...
-
No products found
because this supplier's products are not listed.
Kathrin Leppek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Harumoto,
bioRxiv - Microbiology 2023
Quote:
... 6 µl GFP-Trap magnetic agarose (ChromoTek, gtmak-20) pre-equilibrated with dilution buffer was added to the diluted lysates ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Takanari Nakano, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 1-14C-oleic acid was obtained from Moravek Biochemicals Inc ...
-
No products found
because this supplier's products are not listed.
P. Lejeune, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Jiffypots® with weak or abnormal plantlets were discarded and the others were transplanted into 12-cm square plastic cultivation pots filled with 1.5 L of leaf mould and baked clay (4:1) mixed with 6 gr.L−1 of slow release fertilizer (Osmocote Exact Standard 5-6 M, ICL Specialty Fertilizers). The pots were fitted at the bottom with a 2 x 10 cm felt wick and randomly placed on the deck of the cultivation gutters described above ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Takuya Yoshida, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and with varied length varied (3-6 mm depending on the place) (RWD Life science Inc, US and Doric Lenses, Canada). The fiber probe was secured by adhesion bond (Loctite 454 ...
-
No products found
because this supplier's products are not listed.
Andreas K Brödel, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... cell cultures were shifted to 37°C for 3 to 6 hours in an orbital shaker at 180 rpm (New Brunswick Innova 44). Samples were centrifuged for 10 min at 4,500g and cell pellets were resuspended and lysed with B-PER reagent (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 6-8 μM (Spherotech) were washed twice with wash buffer (20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Danielle Sadowski, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... 0.8 mM Valproic Acid (Amsbio), 5 µM A83-01 (Tocris Bioscience) ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Martin Jakubec, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 10% FBS and 1% Pen-Strep) were seeded in 6 well plates pre-coated with poly-L-lysine (Boster). At the same time pBECS were sowed in transwells (TW ...
-
No products found
because this supplier's products are not listed.
Roy A. Ehling, et al.,
bioRxiv - Immunology 2021
Quote:
Transfected cells were sorted for HDR+ by staining for Strep-Tactin-APC 1:100 (IBA lifesciences, Cat: 6-5010-001) and anti-hIgG AF488 1:100 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Roshan Nepal, et al.,
bioRxiv - Microbiology 2023
Quote:
... Resorufin fluorescence was monitored at the 1- hr interval for 6 hours using the CLARIOstar Plus (BMG Labtech, Ortenberg, Germany) microplate reader (excitation = 530 nm ...
-
No products found
because this supplier's products are not listed.
Claudia Matthaeus, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and a secondary Rabbit antibody labelled with 12 nm gold particles (Dianova, 1:30 in 3% BSA/PBS) was applied ...
-
No products found
because this supplier's products are not listed.
Ashley N. Henderson, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Samples were then incubated at 95°C for 20 min with a 1% ninhydrin and 60% acetic acid reaction mix and quantified on a Tecan Infinite® 200 PRO plate reader (Tecan, Grödig, Austria) at 520 nm.