-
No products found
because this supplier's products are not listed.
Ethan W. Hollingsworth, et al.,
bioRxiv - Genomics 2023
Quote:
... the cHS4 insulator sequence was cloned from genomic chicken DNA (Zyagen, GC-314) using the primers published in Bhatia et al (Bhatia et al. ...
-
No products found
because this supplier's products are not listed.
Deborah L. Gater, et al.,
bioRxiv - Biophysics 2022
Quote:
... Vitamin D binding protein (DBP, Globulin GC) was bought from Athens Research (Georgia, US) & Vitamin D receptor (VDR ...
-
No products found
because this supplier's products are not listed.
Xueao Zheng, et al.,
bioRxiv - Plant Biology 2023
Quote:
... was grinded in liquid nitrogen and were extracted by using 3 mL Methyl-tert-butyl ether/methanol/water (10:3:2.5, V/V) containing 10 ng D4-SA (CDN Isotopes, Pointe-Claire, Canada) for 1 h at room temperature ...
-
This antibody is a chicken polyclonal antibody which specifically reacts with GC.
Cat# BRD-0955MZ,
Inquiry
Ask
Samantha L. Fossa, et al.,
bioRxiv - Biochemistry 2023
Quote:
... N-Acetyl-D-glucosamine-6-phosphorylcholine (GlcNAc-6-PC) and N-acetyl-D-glucosamine-6-phosphoethanolamine (GlcNAc-6-PE) were synthesized by Creative Biolabs (Shirley, NY, USA). 6-O-phosphorylcholine-D-glucopyranose (Glc-6-PC) ...
-
No products found
because this supplier's products are not listed.
MI Oliveira da Silva, et al.,
bioRxiv - Neuroscience 2021
Quote:
... in TBS-T or 5%BSA (NZYTech) in TBS-T for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
Adrienne R. Guarnieri, et al.,
bioRxiv - Physiology 2021
Quote:
... IL-6 (Bioss BSKM1004) and TNF-α (Bioss BSKM1002 ...
-
No products found
because this supplier's products are not listed.
Olivia M. S. Carmo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit α0801 (1:1000, gift from T. de Koning Ward and P. Gilson [9]), rabbit αMESA (1:1000 ...
-
No products found
because this supplier's products are not listed.
Taras Pasternak,
bioRxiv - Plant Biology 2020
Quote:
Protoplasts were isolated from 4–6-weeks-old alfalfa (Medicago sativa L ...
-
No products found
because this supplier's products are not listed.
zhanjun li, et al.,
bioRxiv - Genomics 2019
Quote:
... The PCR products were purified and cloned into the pGM-T vector (TIANGEN, Beijing, China); at least 10 positive plasmid clones were sequenced and analyzed using NCBI BLAST.
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... membranes were washed in PBS-T and were incubated with α-C1q (Complement Technologies, A200), α-C1r (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Nadejda Bozadjieva Kramer, et al.,
bioRxiv - Physiology 2020
Quote:
Insulin levels (6-hour fasting) were measured with ELISAs (Crystal Chem) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hayden A. M. Hatch, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The dSO vial was immediately cleared and placed in one arm of a T-maze (CelExplorer Labs) and an empty vial in another ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Md. Golam Kibria, et al.,
bioRxiv - Biophysics 2022
Quote:
... 200 μL of protein samples in a 3-mm optical path length quartz cuvette (T-507, TOSOH, Japan) was used for the measurements ...
-
No products found
because this supplier's products are not listed.
Marc Emmenegger, et al.,
bioRxiv - Immunology 2021
Quote:
... Serum or plasma samples were diluted in sample buffer (1% milk in PBS-T) and dispensed using acoustic dispensing technology employing the ECHO 555 (Labcyte). Thereby ...
-
No products found
because this supplier's products are not listed.
Yan Zou, Tian Chi,
bioRxiv - Cancer Biology 2021
Quote:
The cytolytic capability of CAR T cells over a 180-h period was monitored using xCELLigence RTCA system (ACEA Biosciences). MDA-MB-453 or U251-CD133OE were plated in E-plate (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
James P Farmer, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... cell culture medium was removed from T-175cm2 flasks containing confluent adherent Hek-ssβ2-AR and replaced with 10ml Tag-lite medium (LABMED, Cisbio Bioassays) containing 100nM SNAP-Lumi4-Tb (Cisbio Bioassays ...
-
No products found
because this supplier's products are not listed.
Orsolya Németh-Szatmári, et al.,
bioRxiv - Molecular Biology 2022
Quote:
6 × 105 cells/flask were seeded into T25 cell culture flasks (Biologix, Jinan, Shandong, China) and left to grow for 24 h ...
-
No products found
because this supplier's products are not listed.
Niels Pietsch, et al.,
bioRxiv - Physiology 2024
Quote:
A control hiPSC line carrying a monoallelic mTag-RFP-T-TUBA1B (clone AICS-0031-035, Allen Institute for Cell Science, Seattle, WA, USA) was expanded and used to create SVBP-KO and TTL-KO hiPSC lines with CRISPR/Cas9 technology ...
-
No products found
because this supplier's products are not listed.
Takaoki Kasahara, et al.,
bioRxiv - Genomics 2022
Quote:
... or 6 along with its flanking intron regions containing appropriate restriction enzyme sites was synthesized (Biomatik or Genewiz). Each exon of mouse Asmt gene in pcDNA5-FRT-TO was replaced with the human form using the appropriate restriction enzymes ...
-
No products found
because this supplier's products are not listed.
Lior Tal, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Arabidopsis KAI2 protein was expressed as a 6× His-SUMO fusion protein using the expression vector pSUMO (LifeSensors). His-SUMO-KAI2 was isolated from by Ni-NTA resin and the eluted His-SUMO KAI2 was further separated by anion-exchange ...
-
No products found
because this supplier's products are not listed.
Steven Henikoff, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... All subsequent steps through to library preparation and purification f ollowed t he standard CUT&Tag-direct protocol (19) using pAG-Tn5 (Epicypher cat. no. 15-1117), except that 1 ...
-
No products found
because this supplier's products are not listed.
Zheng Han, et al.,
bioRxiv - Bioengineering 2019
Quote:
... into a 6-ml ISOLUTE® Single Fritted Reservoir column with 10 μm polyethylene frit (Biotage, Charlotte, NC, USA), followed by washing with 5 mL PBS ...
-
No products found
because this supplier's products are not listed.
Koral Goltseker, et al.,
bioRxiv - Neuroscience 2022
Quote:
... the mice were habituated to collect 5-6 sucrose pellets (45 mg, Dustless Precision Pellets, Bio-Serv, Frenchtown, NJ, USA) from a plastic plate inserted into the home cage ...
-
No products found
because this supplier's products are not listed.
Steven D. De Michino, et al.,
bioRxiv - Genomics 2023
Quote:
... a predetermined quantity (10-300 ng SU-DHL-6 cfDNA) was diluted in RPMI 1640 (Wisent Bioproducts, CAT #350-000-CL) and subjected to ChIP-Seq adapted from Sadeh et al21 ...
-
Recombinant Antigen
Cat# REC31603-100,
100µg USD $496.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Neeltje van Doremalen, et al.,
bioRxiv - Microbiology 2021
Quote:
... Tissues were processed using a VIP-6 Tissue Tek, (Sakura Finetek, USA) tissue processor and embedded in Ultraffin paraffin polymer (Cancer Diagnostics, Durham, NC). Samples were sectioned at 5 µm ...
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
Anti-RNP was detected in female 52 week old C57Bl/6 and 32-52 week old NZM2328 mice (harvested at time of nephritis or at 52 weeks) via ELISA (Alpha Diagnostics, San Antonio, TX) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Yuxin Lin, et al.,
bioRxiv - Biophysics 2024
Quote:
... supplemented with 10% tetracycline-free FBS (Neuromics, no. FBS002-T) and 1 × penicillin-streptomycin (Corning ...
-
No products found
because this supplier's products are not listed.
Yu-Heng Tseng, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were saturated with 5% milk powder in PBS with 0,05% Tween-20 (PBS-T) followed by immunostaining with anti-GFP antibodies (Torrey Pines Biolabs, 1:5000 in PBS-T) and secondary goat-anti-rabbit antibodies coupled to alkaline phosphatase (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Elisa Claeys, et al.,
bioRxiv - Immunology 2021
Quote:
... T cells were activated by adding Staphylococcal enterotoxin E (Toxin Technology) or Staphylococcal enterotoxin B (Sigma-Aldrich)-stimulated Raji-GFP cells at a concentration of 1.2 × 106 cells/mL ...
-
No products found
because this supplier's products are not listed.
Natasha Ting Lee, et al.,
bioRxiv - Neuroscience 2023
Quote:
Recombinant mouse t-PA (0.9 mg/kg; Molecular Innovations, MI, USA) or saline (equi-volume ...
-
No products found
because this supplier's products are not listed.
Steven J. Hersch, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... we amplified the cassette by PCR using Taq (Froggabio T-500) or Q5 (NEB M0491 ...
-
No products found
because this supplier's products are not listed.
E O’Hara, et al.,
bioRxiv - Microbiology 2022
Quote:
The concentration of bromoform in each of the three seaweeds was determined using a Shimadzu QP2010 Ultra GC/MS system at a commercial laboratory (Bigelow Analytical Services, USA). Bromoform concentration was recorded as mg/g dry weight.
-
No products found
because this supplier's products are not listed.
Sylwia Machcinska, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Inc.)-conjugated cytokeratin 6 (CK6; NSJ Bioreagents, Cat # V2168) antibodies ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Haley N. Bridge, Clara L. Frazier, Amy M. Weeks,
bioRxiv - Biochemistry 2023
Quote:
... Azide-SS-biotin (6) was purchased from Broadpharm. Biotin-Diazo-azide (9) ...
-
No products found
because this supplier's products are not listed.
Erdem D. Tabdanov, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human CD4+ T cells were plated on a glass-bottom dish (Willco Wells) pre-coated with either ICAM-1 (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Mehri Monavarian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
CD8+ T cells were isolated from normal healthy female PBMCs (Precision for Medicine) using Miltenyi Biotec ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... EPA 200.7 standard 6 purchased from High-Purity Standards was used for calibration ...
-
No products found
because this supplier's products are not listed.
Maitreyi S. Joshi, et al.,
bioRxiv - Systems Biology 2022
Quote:
... atto-590azide (6 mM, ATTO-TEC GmbH, Siegen, Germany) dissolved in DMSO was mixed with aqueous solution of click-chemistry grade CuSO4 (40mM ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
Sanja Vickovic, et al.,
bioRxiv - Genomics 2020
Quote:
... we created poly(d)T arrays in-house according to manufacturer’s instructions (Codelink, Surmodics, USA) using amine-activate slides ...
-
No products found
because this supplier's products are not listed.
Barun Das, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 100 μM N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (AdipoGen Life Science, San Diego, CA) was added to the culture media simultaneously with tamoxifen treatment.
-
No products found
because this supplier's products are not listed.
Charles Limouse, et al.,
bioRxiv - Genomics 2023
Quote:
... 25 µM annealed ChAR-seq bridge (top strand: /5rApp/AANNNAAACCGGCGTCCAAGGATCTTTAATTAAGTCGCAG/3SpC3/; bottom strand: /5Phos/GATCTGCGACTTAATTAAAGATCCTTGGACGCCGG/iBiodT/T; individual strands ordered from IDT DNA) ...
-
No products found
because this supplier's products are not listed.
Andy He, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A Rosa26LSL-DNAJB1-PKA-GFP C56BL/6 founder mouse was generated and validated by Applied StemCell using a site-specific integrase via pronuclear injection [72] ...