-
No products found
because this supplier's products are not listed.
Helen J. von Richthofen, et al.,
bioRxiv - Immunology 2022
Quote:
... or proteinase 3 (Elastin Products Company) (all 1 μM) ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Hassan E. Eldesouky, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 6-Gingerol were obtained from Ark Pharm (Arlington Heights, IL). Atorvastatin was obtained from Selleckchem (Radnor ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interleukin 6 (IL6) ELISA Kit (RD-IL6-Mu, Reddot biotech), Mouse Interferon Gamma Induced Protein 10kDa (IP10 ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... ICP-MS standards QCP-QCS-3 (Inorganic Ventures) and QCS-27 (High Purity Standards ...
-
No products found
because this supplier's products are not listed.
Otto Kauko, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Antibodies to Tcf4 (Clone 6H5-3 Exalpha Biologicals), β-catenin (Rabbit Polyclonal Antibody ...
-
No products found
because this supplier's products are not listed.
Shabnam Ghiasvand, et al.,
bioRxiv - Neuroscience 2022
Quote:
6-well tissue culture plates were transferred to an interface chamber (Bioscience Tools) connected to a temperature controller maintaining temperature at 37 °C and a blood gas providing 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Carole Y. Perrot, et al.,
bioRxiv - Immunology 2023
Quote:
... immersed in a pH=6 antigen retrieval solution (IHC World, Elliott City, MD) and placed in a steamer for 40 min at 95-98°C ...
-
No products found
because this supplier's products are not listed.
Hao Wang, et al.,
bioRxiv - Biochemistry 2024
Quote:
The gel was prepared with a concentration of 6% (wt/vol) agarose (HydraGene Co. ...
-
No products found
because this supplier's products are not listed.
Xiao Lin, et al.,
bioRxiv - Plant Biology 2020
Quote:
A BAC library of plant GIG362-6 was generated by Bio S&T (Canada). A BAC clone that spans the mapping interval was isolated using molecular markers (Table S2 ...
-
No products found
because this supplier's products are not listed.
Jennifer McDonald, Catherine J. Merrick,
bioRxiv - Microbiology 2021
Quote:
Mature schizont cultures at >6% parasitaemia were synchronised using 55% Nycodenz (Alere technologies AS). Cultures were centrifuged and media removed to leave 2ml of media and blood ...
-
No products found
because this supplier's products are not listed.
KR Bowles, et al.,
bioRxiv - Neuroscience 2023
Quote:
Monomeric recombinant tau of each of the 6 major isoforms was purchased from rPeptide, and was labelled using the pHrodo Red Microscale Protein Labeling kit (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Jae Yeong Ha, et al.,
bioRxiv - Pathology 2023
Quote:
... Tissue samples were analyzed using the ELISA kits for IL-6 (KET7009; Abbkine, Wuhan, China) and TNF-α (ADI-900- 047 ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
We printed our arrays with the PDC70 type 3 nozzle (Scienion) due to its reduced dispense volume and the specific hydrophobic coating optimized to improve the dispense stability of protein solutions ...
-
No products found
because this supplier's products are not listed.
Shivani Ahuja, et al.,
bioRxiv - Biochemistry 2020
Quote:
... the protein was mixed 2:3 with monoolein (Nu-Chek Prep) and then 70 nl of this material was deposited on a glass slide (Molecular Dimensions) ...
-
Cat# DDBI-CL-96-F,
USD $161.35/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Natalia Sanchez de Groot, et al.,
bioRxiv - Systems Biology 2019
Quote:
... Aβ42 was inserted 3’prime of the GFP (TRP-URA-AB vector) using the In-Fusion® HD Cloning Kit (Clontech ...
-
No products found
because this supplier's products are not listed.
A Prabhakar, et al.,
bioRxiv - Immunology 2021
Quote:
... 2-3 ml blood was collected in RNAgard blood tubes (Biomatrica, USA) and stored in −80°C until RNA precipitation ...
-
No products found
because this supplier's products are not listed.
Elena Martínez-Balsalobre, et al.,
bioRxiv - Genetics 2021
Quote:
... A 3-mm-diameter platinum plate electrode (CUY 650-P3 Tweezers, Protech International) localized the pulses to approximately the dorsal one-half of the fin ...
-
No products found
because this supplier's products are not listed.
Yann Ehinger, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-VGUT1 antibody (VGT1-3) was purchased from Mab Technologies (Stone Mountain, GA). Other common reagents were from Sigma Aldrich (St ...
-
No products found
because this supplier's products are not listed.
Eileen M. Lynch, et al.,
bioRxiv - Pathology 2024
Quote:
... Amplified samples were run on a 2% agarose gel (Lamda Biotech, Inc., A113-3) containing 0.5μg/mL ethidium bromide (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Christoph Schmitz, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2-axis computer-controlled stepping motor system (4”× 3” XY; Prior Scientific, Jena, Germany), focus encoder (Heidenhain ...
-
No products found
because this supplier's products are not listed.
Sandra Schwarz, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... respective wells were treated with 400µM PI-9i (1,3-Benzoxazole-6-carboxylic acid, Advanced ChemBlocks Inc, Hayward, CA, USA). Following pre-treatment ...
-
No products found
because this supplier's products are not listed.
Marine Tessier, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Microglia interleukines production was analyzed the same way with the Mouse Interleukin 6 ELISA Kit (Biosensis®, BEK-2043-1P) and the Mouse Interleukin 10 ELISA Kit (Biosensis® ...
-
No products found
because this supplier's products are not listed.
Lama El Cheikh Hussein, et al.,
bioRxiv - Neuroscience 2021
Quote:
... tail-tip blood (6 µl) was collected from 4 mice at ZT7 and ZT12 to check corticosterone levels (ELISA kit From Assaypro).
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Jessica L. Kelliher, et al.,
bioRxiv - Microbiology 2023
Quote:
... Endpoint kinase assays were performed by mixing 3 μg purified PrkA1- 338 with the indicated combinations of ∼3x molar excess of substrate to kinase (6 μg of the generic kinase substrate myelin basic protein [MBP; Novatein Biosciences, Woburn ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
G. Caplen, S.D.E. Held,
bioRxiv - Zoology 2021
Quote:
Saliva was collected (Day 3) using a cotton swab (SalivaBio Children’s Swab, Item No. 5001.06, Salimetrics) and then immediately stored at −80°C prior to analysis ...
-
No products found
because this supplier's products are not listed.
Dieter G. Müller, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Colchicine treatment was performed using a disk of filter paper of 6 mm diameter loaded with 1 mg of colchicine (Fluka, Honeywell Research Chemicals), which was placed in the centre of an agar plate filled with gametophyte material ...
-
No products found
because this supplier's products are not listed.
Nicholas F. Page, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Serum was diluted with PBS/0.2%BSA to fall into the linear range of a primate-specific IL-6 ELISA assay (Cell Sciences, Canton, MA), and the assay was performed according to the manufacturer’s instructions (see ref 25) ...
-
No products found
because this supplier's products are not listed.
Rio Ikuta, Yuu Kakinohana, Shun Hamada,
bioRxiv - Neuroscience 2023
Quote:
... the nuclei were labeled with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) and then coverslipped with a mounting medium (Fluoroshield Mounting Medium; ImmunoBioScience, CA, USA). Images were obtained using a fluorescence microscope (Eclipse E800 ...
-
No products found
because this supplier's products are not listed.
Biao Yuan, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and desalting (3 min) was driven with an isocratic HPLC pump (IPro-500, IRIS Technologies, Lawrence, KS) at a flow rate of 100 µL min-1 through the 50-µL sample loop ...
-
No products found
because this supplier's products are not listed.
Cathrin LC Gudd, et al.,
bioRxiv - Immunology 2023
Quote:
... 20 μg/mouse of TLR9-L (CpG oligodeoxynuleotide 1668: 5-S-TCCATGACGTTC CTGATGCT-3) (TIB Molbiol, Germany) was administered i.p ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
Tam Vo, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The expression and purification of the HNRNPH1 truncated proteins qRRM1-2 and qRRM2-3 (Creative BioMart, Shirley, NY) were performed as described previously (23) ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
Giovanni S. Offeddu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
MVNs were cultured using Vasculife Endothelial Medium (LL-0003, Lifeline) and pooled HUVECs (GFP-expressing, Angio-Proteomie, 6 million ml-1 after five passages) and nHLFs (Lonza ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Sarah C. Donnelly, et al.,
bioRxiv - Microbiology 2022
Quote:
... samples containing 1–3 mg/mL of protein were evaluated using ICP-MS (Biotron Analytical Services, Western University, London, Canada). Briefly ...
-
No products found
because this supplier's products are not listed.
Tatsuaki Kurata, et al.,
bioRxiv - Microbiology 2021
Quote:
... Next day the plasmid was extracted from 3 mL of the culture using Favorprep Plasmid Extraction Mini Kit (Favorgen Biotech Corp.). 500 ng of the plasmid mix was again transformed into BW25113 carrying a toxin expression plasmid and let to recover as before ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Ahmed Ali, et al.,
bioRxiv - Biophysics 2023
Quote:
... and sequentially in 1:3 dilution steps added to the wells of PEG-BSA coated ELISA plates (PBSA20PL, Life Diagnostics, Inc.) The plates were incubated for 2 h at RT to allow antibody binding ...