-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Susan Hromada, et al.,
bioRxiv - Systems Biology 2021
Quote:
Genomic DNA was quantified using Sybr Green fluorescence assay with a 6-point DNA standard curve (0, 0.5, 1, 2, 4, 6 ng/μL Biotium). 1 μL of samples and 5 μL of standards were diluted into 95 μL of 1X SYBR Green (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Anna V. Protasio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Worms were rinsed in PBS (3×10mins, 3 × 1hr) and equilibriated in mounting media with 4’,6-diamidino-2-phenylindole DAPI (Fluoromount G, Southern Biotech, Birmingham, AL) overnight before mounting and imaging.
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Miqdad O. Dhariwala, et al.,
bioRxiv - Immunology 2020
Quote:
... and skin was minced finely with dissection scissors and mixed in a 6-well plate with 3 ml of digestion buffer consisting of 0.8 mg/ml Collagenase Type 4 (4188; Worthington), 0.02 mg/ml DNAse (DN25-1G ...
-
No products found
because this supplier's products are not listed.
Wenjian Lv, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were passaged (1:12) every 3-4 days using StemMACS Passaging Solution XF (Miltenyi Biotec) and Y-27632 dihydrochloride (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Chengyuan Wang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples (3 μl) were applied to Quantifoil 2/1 Cu 300 holey-carbon grids (Quantifoil) glow-discharged 60 s using a PELCO glow-discharge system (Ted Pella) ...
-
No products found
because this supplier's products are not listed.
Seraphine Kamayirese, et al.,
bioRxiv - Biochemistry 2023
Quote:
(His)6-14-3-3ε was commercially obtained from Novus Biologicals (Centennial CO, USA), and 14-3-3ε-(His)12 was expressed in our laboratory (see details on protein expression in the supporting information) ...
-
No products found
because this supplier's products are not listed.
Yu-Chia Chen, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples for Immunostaining were fixed in 2% PFA or 4% 1-ethyl-3 (3-dimethylaminopropyl)-carbodiimide (EDAC, Carbosynth, Berkshire, UK). The fixed brains were dissected to enhance antigen presentation and to improve image quality.
-
No products found
because this supplier's products are not listed.
Eleonora Grisard, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-human 14-3-3 1/1000 (EPR6380, GeneTex), rabbit anti-human Lamp1 1/1000 (clone EPR4204 ...
-
No products found
because this supplier's products are not listed.
Han Zhu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
No products found
because this supplier's products are not listed.
Lei Chen, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... ATPase (MBL International Corp. D032-3, 1:200), P63 (Santa Cruz sc-8343 ...
-
2-Oxo-3-phenylpropanoic acid (Phenylpyruvic acid) is used in the synthesis of 3-phenyllactic...
Cat# S6131, SKU# S6131-25mg,
25mg, $97.00
Ask
Liying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
The D1 receptor antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepi ne hydrochloride (SCH-23390, Selleck chemicals, China) was dissolved in 0.9% saline and stored -80°C ...
-
Building Block
Sold for research purposes only.
Cat# 1177.0, SKU# 1177-1000 mg,
Inquire
Ask
Isabel R.K. Kuebler, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The MCH receptor antagonist 6-(4-Chloro-phenyl)-3-[3-methoxy-4-(2-pyrrolidin-1-yl-ethoxy)-phenyl]-3H-thieno[3,2-d]pyrimidin-4-one (GW803430) (Axon Medchem, Groningen, Netherlands) was freshly prepared the day of the treatment ...
-
No products found
because this supplier's products are not listed.
Zhongyun Xie, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the lysate was made from 1∼2 ml packed worms with 3∼4 ml of 0.5-mm diameter glass beads using FastPrep-24 (MP Biomedicals) in lysis buffer [pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Irshad Akbar, et al.,
bioRxiv - Immunology 2023
Quote:
... or Th17 – rhTGFβ (3 ng mL-1, Miltenyi) + rmIL-6 (20 ng mL-1, Miltenyi) + anti-IFNγ (10 μg mL-1, BioXcell). Cells were then transferred to uncoated tissue culture plates and cultured for an additional 3 days ...
-
No products found
because this supplier's products are not listed.
Martin Baccino-Calace, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Larvae were dissected and sharp-electrode recordings were made from muscle 6 in abdominal segments 3 and 4 using an Axoclamp 900A amplifier (Molecular Devices). The extracellular HL3 saline contained (in mM) ...
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Robert J Stott, Toshana L Foster,
bioRxiv - Microbiology 2021
Quote:
... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Görkem Garipler, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and 2-inhibitor cocktail (3 mM CHIR (BioVision) and 1 mM PD0325901 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Hao Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3% triton X-100 (4 min, Solarbio, Beijing, China), and goat serum (15 min ...
-
No products found
because this supplier's products are not listed.
Ju-Fang Chang, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were imaged every 4-6 hours for 3-7 days using the IncuCyte® Live-Cell Analysis System (Sartorius). 5 images per well at 10x zoom were collected at each time point ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... or 1 mg 4-hydroxy-3- nitrophenyl (NP)-OVA (LGC Biosearch Technologies, N-5051-100) by oral gavage with 5 μg cholera toxin (List Biological Labs ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Saphala Dhital, Naren R. Vyavahare,
bioRxiv - Bioengineering 2019
Quote:
DiR (1, 1-dioctadecyl-3, 3, 3, 3-tetramethylindotricarbocyanine iodide) (PromoCell GmbH, Heidelberg, Germany) loaded BSA (Seracare ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Nittay Meroz, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The optical density was then measured using 6 automated plate readers (3 Epoch2 microplate reader - BioTek and 3 Synergy microplate reader - BioTek) simultaneously ...
-
No products found
because this supplier's products are not listed.
Samantha L. Wilson, et al.,
bioRxiv - Genomics 2021
Quote:
... Labs 1 and 3 used Antibody 1 (Diagenode, Denville ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Natalia Benetti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
No products found
because this supplier's products are not listed.
Georgina Gyarmati, et al.,
bioRxiv - Physiology 2021
Quote:
... animals underwent brief anesthesia sessions every 3–4 days using 1%–2% isoflurane and the SomnoSuite low-flow anesthesia system (Kent Scientific, Torrington, CT). Body temperature was maintained with a homeothermic blanket system (Harvard Apparatus) ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Bert Vanmechelen, et al.,
bioRxiv - Microbiology 2021
Quote:
... using 3:1 TransIT-LT1 Transfection Reagent (Mirus Bio). Twenty-four hours later ...
-
No products found
because this supplier's products are not listed.
Hela Benaissa, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Image stacks were obtained at 2-or 3-min intervals either with a 10× objective (CFI Plan APO LBDA, NA 0.45, Nikon; z-step = 4 μm) or a 100× oil immersion objective (APO VC ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... (2- (Dimethylamino)-N-(6-oxo-5,6-dihydrophenanthridin-2-yl)acetamide hydrochloride (PJ34; A41159, ApexBio) N-(p-amylcinnamoyl ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Camille Mazo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... An array of 4 tungsten electrodes (∼3 MΩ; FHC) was glued together and was slowly lowered into the OB ...
-
No products found
because this supplier's products are not listed.
Zachary Beine, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The primary antibody (2-3% serum, 0.4% PBST, 1:500 Rockland 600-401-379) was applied and incubated for ninety minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
S. P. Maher, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vivax cases were infected into PHH lot BGW at day 2 post-seed (for case 1) or day 3 post-seed (for cases 2 and 3) in 384-well plates (Greiner Bio-One cat 781956) using the same methods for initiating P ...
-
No products found
because this supplier's products are not listed.
Michele Bortolomeazzi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... the slides were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Akoya Biosciences) and coverslipped using ProLong Gold antifade mounting media (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Ashwathi Rajeevan, Riya Keshri, Sachin Kotak,
bioRxiv - Cell Biology 2020
Quote:
Double-stranded siRNA oligonucleotides used were 5’- CAGUACCAGUGAGUGGCCCCACCUG-3’ (NuMA 3’UTR siRNA; Eurogentec) and 5’-CACCGUGUGUCUAAGCAAA-3’ (RCC1 siRNA ...
-
No products found
because this supplier's products are not listed.
Jae Won Lee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 3-oxo-DCA were purchased from Steraloids (Newport, RI, USA). Isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Ryann M. Fame, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5–10 μL of CSF or serum was extracted in 4:6:3 chloroform:methanol:water mixture supplemented with isotopically labeled T3 and T4 (at 100 nM, Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
Ana S Almeida, et al.,
bioRxiv - Microbiology 2021
Quote:
... and three 3–4 mm sterile glass beads (Biospec Products). Next ...
-
No products found
because this supplier's products are not listed.
Matthew S.J. Mangan, et al.,
bioRxiv - Immunology 2021
Quote:
... Rac1/2/3 (1:1000, rabbit polyclonal #2465) from CST, actin (mouse or rabbit, both 1:1,000 dilution) from LI-COR Biosciences ...