-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... On day 6 the cells were detached using CnT-Accutase-100 (CELLnTEC) and counted.
-
No products found
because this supplier's products are not listed.
Garth Blackler, et al.,
bioRxiv - Physiology 2023
Quote:
... and further decalcified for 6 days in Formical-2000 (StatLab, PC-1314-32). Decalcified tissue was processed ...
-
No products found
because this supplier's products are not listed.
Sanjoy Paul, et al.,
bioRxiv - Microbiology 2022
Quote:
... with intermittent vortexing of 30 seconds at setting 6 (Vortex Genie 2 Scientific Industries) every 2 min ...
-
No products found
because this supplier's products are not listed.
Jean-Marc Aury, et al.,
bioRxiv - Genomics 2022
Quote:
... 3’-adenylated and Illumina adapters (Bioo Scientific, Austin, TX, USA) were then added using the Kapa Hyper Prep Kit (KapaBiosystems ...
-
No products found
because this supplier's products are not listed.
Charles D Cox, et al.,
bioRxiv - Biophysics 2021
Quote:
... and the cells broken with a TS5/48/AE/6□A cell disrupter (Constant Systems) at 31,000□psi at 4°C ...
-
No products found
because this supplier's products are not listed.
Ruhul Amin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 6-well plates with elastic moduli of 0.2 kPa (considered soft) was purchased from Matrigen. Regular 6-well tissue culture dishes were used to represent stiff matrices (elastic moduli is >GPa) ...
-
No products found
because this supplier's products are not listed.
Jiang-An Yin, et al.,
bioRxiv - Genomics 2023
Quote:
... Viral titers of the sgRNA libraries were determined by a 6-point dose response in 6-well plates by puromycin selection and determination of live and dead cells (T.spiezzo, Cellecta) or flow cytometry of RFP+ cells (Brunello ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the N-terminal tag was removed by incubation with HRV 3C protease (AG Scientific) and further purified by Superose 6 column ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Matthew J. Foulkes, et al.,
bioRxiv - Immunology 2019
Quote:
... The c-Jun N-terminal kinase inhibitor SP600125 was obtained from StressMarq Biosciences (Victoria, Canada), and tanshinone IIA (TIIA ...
-
No products found
because this supplier's products are not listed.
Ankita Leekha, et al.,
bioRxiv - Immunology 2022
Quote:
... We obtained the positive controls (anti-N and anti-S IgG) from Abeomics (CA, USA)
-
No products found
because this supplier's products are not listed.
Michel Engeln, et al.,
bioRxiv - Neuroscience 2019
Quote:
... mice were injected with 0.5mg/kg clozapine-N-oxide (i.p.; LKT Laboratories, St. Paul, MN, USA) 30 min prior to behavioral testing.
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and incubated with target antibodies at 4C o/n (GFP (1:500, Antibodies Incorporated Cat# GFP-1020, RRID:AB_10000240), HSP60 (1:200 ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Bijoya Sen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Blood was collected from healthy donors (N=5) and PBMCs were isolated using Lymphoprep™ (Alere Technologies AS, Oslo, Norway) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Gabriella T. Heller, et al.,
bioRxiv - Biophysics 2020
Quote:
... recombinant Aβ42 peptide (the 42-residue variant lacking the N-terminal M, see ‘Preparation of recombinant Aβ peptides’) was purchased from rPeptide and prepared following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Neha Ahuja, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Genotypes were determined by polymerase chain reaction (PCR) after O/N digestion using DirectPCR (Tail) Lysis buffer (Viagen, Los Angeles, CA) per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Satoru Hoshino, et al.,
bioRxiv - Zoology 2021
Quote:
We measured the body mass of all animals before and after the sampling periods in each experiment (N. larvatus: Digital Platform Scale, DP-8100, Yamato, Japan; T. cristatus: SD75LJP, OHAUS Corporation, USA), by offering weighing platforms on which the animals stepped voluntarily.
-
No products found
because this supplier's products are not listed.
Sandrine Valade, et al.,
bioRxiv - Immunology 2021
Quote:
... VWF antigen (Ag) (N: 50-150 IU/dL) was measured using the automated STA-Liatest VWF:Ag® (Diagnostica Stago, Asnières-sur-Seine, France). ADAMTS13 activity (N ...
-
No products found
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
No products found
because this supplier's products are not listed.
Maya A. Farha, et al.,
bioRxiv - Microbiology 2020
Quote:
Overnight cultures of the collection22 (at a 96-well density, n = 289) were performed using the Singer rotor HDA (Singer Instruments, United Kingdom) in CAMHB ...
-
No products found
because this supplier's products are not listed.
Ayodeji B. Oyenihi, et al.,
bioRxiv - Microbiology 2024
Quote:
... Historical vaginal specimens (n = 946) marked for disposal were received in OneSwab® (Copan Diagnostics, CA, USA) or ThinPrep® (Hologic, MA, USA) transport media in a Clinical Laboratory Improvement Amendments (CLIA)-certified infectious disease laboratory facility between January and June 2023 and stored at −80 °C were selected randomly for this study ...
-
No products found
because this supplier's products are not listed.
André Folgado, Rita Abranches,
bioRxiv - Plant Biology 2021
Quote:
... Protein bands were identified using the Edman reaction and a Procise 491 HT Protein Sequencer to determine the N-terminal sequences (Analytical Laboratory, Analytical Services Unit, ITQB NOVA).
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Two biotinylated glycan analogs (3’SLN: Neu5Acα2-3Galβ1-4GlcNAcβ and 6’SLN: Neu5Acα2-6Galβ1- 4GlcNAcβ) were purchased (GlycoTech, Gaithersburg, MD). Three biotinylated glycans Neu5Acα2- 3Galβ1-4(Fucα1-3)GlcNAcβ (sLeX) ...
-
No products found
because this supplier's products are not listed.
Sharvari Narendra, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 6 rubber stoppers (#6R, Ancare, Bellmore, NY) containing stainless steel ball-bearing sippers (TD-100 ...
-
No products found
because this supplier's products are not listed.
Jack P. K. Bravo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and nanoPOP-6 polymer (Molecular Cloning Laboratories). The oven temperature was set to 65°C ...
-
No products found
because this supplier's products are not listed.
Siran Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 150 pmol of 6×His-streptavidin (ProteoGenix) was mixed with 5 μl of sieved beads (10% ...
-
WB, ChIP, DB, ICC/IF
Cat# CDC-104,
0.025 mg;0.05 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Douglas S. Reed, et al.,
bioRxiv - Microbiology 2023
Quote:
... −6 to −15 psi (AGI; Ace Glass, Vineland, NJ). Particle size was measured once during each exposure at 5 minutes using an Aerodynamic Particle Sizer with a diluter at 1:100 (TSI ...
-
No products found
because this supplier's products are not listed.
Shankar Thangamani, et al.,
bioRxiv - Microbiology 2021
Quote:
... ampicillin (69-52-3, IBI Scientific), and streptomycin (S6501 ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Dakota R. Robarts, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and GenX (Synquest Laboratories cat # 2122-3-09, lot # 00008887) were dissolved in 0.5% Tween-20 at final concentrations of 0.067 g/L ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Jian Hang Lam, et al.,
bioRxiv - Immunology 2022
Quote:
... The plate was left to incubate for 6 hours followed by addition of the ESF-AF medium (Expression systems). Sf9 cells were left for seven days at 27 °C without agitation ...
-
WB, IHC, IF,ELISA
Cat# A5442, SKU# A5442-100ul,
100ul, $157.00
Ask
Yi Ran, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... cell extracts (3 ml of the supernatant) were incubated with Anti-Flag Affinity Gel (Bimake) at 4 °C for 3 h ...
-
No products found
because this supplier's products are not listed.
Danielle L. Michell, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Bone marrow cells were isolated from wild-type C57BL/6 mouse femurs and differentiated to bone marrow-derived macrophages (BMDM) using murine GM-CSF (50ng/mL, Tonbo Biosciences) in DMEM (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...