-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
WB,ELISA
Cat# A5031, SKU# A5031-100ul,
100ul, $157.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Lindsey Van Haute, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Bisulfite conversion of 2 µg DNase treated RNA was performed using the Methylamp One-Step DNA modification kit (Epigentek). The reaction mixture was incubated for three cycles of 90°C for 5 min and 60°C for 1h ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Anne Berthold, Vett Lloyd,
bioRxiv - Molecular Biology 2022
Quote:
... starting material for the exposure experiments were HUVECs in passage 3 and HEK-293 cells in passage 5 seeded at a density of 4000 cells/cm2 into 6-well tissue culture plates (Celltreat, 229105) in antibiotic-containing media ...
-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... 500 μL single-cell suspensions were incubated at 37 °C for 6 h with 5% CO2 in 48-well plates in the presence of Cell Stimulation Cocktail (Tonbo Biosciences, #TNB-4975). Stimulated cells were stained with surface markers as described above ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Joyce Rigal, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... flies was extracted with TRI Reagent at 5 to 6 days and 30 to 31 days old according to the manufacturers protocol (Molecular Research Center, Inc., Cincinnati, OH). To generate RNA-seq libraries ...
-
No products found
because this supplier's products are not listed.
Kathrin Frey, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All-in-one ready-to-use (Cell Applications Inc, 211A-500) without antibiotics.
-
No products found
because this supplier's products are not listed.
Lauren T. Que, Marie E. Morrow, Cynthia Wolberger,
bioRxiv - Biochemistry 2019
Quote:
... 5 (LifeSensors) FRET-K48 diubiquitin ...
-
Cat# 612065-05-1,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP) was obtained from Moravek biochemicals ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Qiong Wang, et al.,
bioRxiv - Immunology 2019
Quote:
One immunization to induce CIA : Bovine type II collagen (2 mg/ml, Chondrex, cat. # 20021) and complete Freund’s adjuvant (4mg/ml M ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Jana Schuettpelz, et al.,
bioRxiv - Cell Biology 2024
Quote:
... cells were incubated with 100 nM CCCP for 1h or Ink128 (MLN0128, AdooQ) for 24 h.
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Robert S. Porter, et al.,
bioRxiv - Molecular Biology 2023
Quote:
One μg of recombinant (Epicypher) or cellular nucleosomes (see protein purification above ...
-
No products found
because this supplier's products are not listed.
Eric Largy, Valérie Gabelica,
bioRxiv - Biophysics 2020
Quote:
... an MX Series II 2 Position/6 Port UltraLife Switching Valve (IDEX Health & Science, Oak Harbor, WA, USA) was used (see Figure S3) ...
-
No products found
because this supplier's products are not listed.
Mathieu Paquette, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cells were incubated for 2 h in medium containing one of the following reagents: Dimethyl sulfoxide (DMSO) (0.1%) (Bioshop Canada, DMS666), Torin1 (1 μM ...
-
No products found
because this supplier's products are not listed.
Laurens H. Lindenburg, et al.,
bioRxiv - Biochemistry 2020
Quote:
... GB1-BRC8-2 lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), followed by the application of monomeric RAD51 lysate ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Kendall Carrasco, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 nL of compounds were dispensed (2 x 2.5 nL fixed dispensing using an Echo550 (Labcyte)) from a concentration stock of 1 mM (100% DMSO ...
-
No products found
because this supplier's products are not listed.
Valeria Garcia-Flores, et al.,
bioRxiv - Immunology 2022
Quote:
... the slides were incubated with DAPI (4′,6-diamidino-2-phenylindole) as a nuclear counterstain and mounted using AquaSlip™ Aqueous Permanent Mounting Medium (American MasterTech). Fluorescence image acquisition was performed using the Vectra Polaris Multispectral Imaging System at 20x magnification ...
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Tessa Acar, et al.,
bioRxiv - Plant Biology 2023
Quote:
... fresh explants were soaked in 3 x concentrated MS medium supplemented with 5% (v/v) solution of Plant Preservative Mixture (PPM, Plant Cell Technology, USA) with shaking at 100 rpm for 8 hours at 28°C (‘PPM protocol’) ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Gerrald A. Lodewijk, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... cells were seeded at 5,000-10,000 cells per cm2 and passaged every 2-3 days using Accutase (Innovative Cell Technologies, AT104).
-
No products found
because this supplier's products are not listed.
Yi Sak Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
BV-2 microglia cell line was cultured in DMEM with 5% FBS and 50 μg/ml gentamicin (Omega Scientific) as described previously5 ...
-
No products found
because this supplier's products are not listed.
Ryan M. Glanz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a pup with a visible milk band was removed from the litter and anesthetized with isoflurane gas (3–5%; Phoenix Pharmaceuticals, Burlingame, CA). A custom-made bipolar hook electrode (0.002-inch diameter ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... Fisher Scientific; 1327-53-3), As(V) (Arsenic V Speciation Standard, Fisher Scientfic; 7732-18-5, AsB (Arsenobetaine Standard Solution, LGC Standards; NIST-3033), DMA (Dimethylarsinic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
One or two liters of Trichoplusia (Tni) cells (Expression System) were infected with recombinant baculoviruses at a cell density of 1.5-2.0 × 106 cells per mL ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Richard M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 6% defibrinated sheep blood (HemoStat Laboratories) and grown at 37°C for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Thomas HB FitzGerald, et al.,
bioRxiv - Neuroscience 2019
Quote:
... which probabilistically generate one of two possible observations ot ∈ {1,2} (Costa et al., 2015; FitzGerald et al. ...
-
No products found
because this supplier's products are not listed.
Ian W. McCahill, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 2 media (Caisson Labs). Aqueous solutions of paclobutrazol and GA3 were freshly prepared and diluted to 0.1 µM and 10 µM respectively in hydroponic media ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Anna C. Deleray, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-hydroxyethyl starch (Spectrum Chemical, H3012) was used.