-
No products found
because this supplier's products are not listed.
Thomas Hoffmann, et al.,
bioRxiv - Genetics 2023
Quote:
... STAG1 was stained with Polink 2 Plus HRP rat NM detection system (GBI Labs #D46-6) according to manufacturer’s instructions using a recombinant rat monoclonal STAG1 antibody (Abcam ab241544 ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Kavya Prasad, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mounted in Vectashield Antifade solution (4’,6 diamidino-2-phenylindole, Vector laboratories H-1200, Axxora/Alexis, Lörrach, Germany) with DAPI and cover with 24×60 mm coverslip sealed with a nail polish ...
-
No products found
because this supplier's products are not listed.
Minal Engavale, et al.,
bioRxiv - Immunology 2023
Quote:
... Portions of the blot were incubated with one of the following primary antibodies for 2 hours at room temperature or overnight: anti-human Dnase1L3 (1:1000) (Abnova and Genetex), pre-immune rabbit serum (1:5000) ...
-
No products found
because this supplier's products are not listed.
Ning Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... One mM final concentration of H-Bpa-OH (Chempep) was added to the medium ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Dian Kortleve, et al.,
bioRxiv - Immunology 2024
Quote:
... 6% human serum (Sanquin, Amsterdam, the Netherlands), 200 mM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
L. A. Fish, et al.,
bioRxiv - Neuroscience 2023
Quote:
... One 28-gauge monopolar needle electrode (Teca, Oxford Instruments Medical, NY) was placed on either side of the sciatic nerve ...
-
No products found
because this supplier's products are not listed.
Thomas HB FitzGerald, et al.,
bioRxiv - Neuroscience 2019
Quote:
... which probabilistically generate one of two possible observations ot ∈ {1,2} (Costa et al., 2015; FitzGerald et al. ...
-
No products found
because this supplier's products are not listed.
Arun Upadhyay, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stock solutions of recombinant Aβ peptides were prepared by solubilizing lyophilized monomers (Aβ38, rPeptide A-1078-2; Aβ40:rPeptide A-1153-2; and Aβ42: rPeptide A-1163-2) in 1% NH4OH at 200 µM concentration as recommended by manufacturer ...
-
No products found
because this supplier's products are not listed.
Ian W. McCahill, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 2 media (Caisson Labs). Aqueous solutions of paclobutrazol and GA3 were freshly prepared and diluted to 0.1 µM and 10 µM respectively in hydroponic media ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... was added to sample 2 (DUBPAN) and 2 μl of OTUB1 (LifeSensors, Cat#: DB201) was added to sample 3 (DUBK48) ...
-
No products found
because this supplier's products are not listed.
Zhipeng Li, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Solution standard: 2 µl of calibration standard #2 (“CEM2”, LGC Standards #VHG-SM70B-100) was added to 200 µl of 50% HNO3 and heated for 2 hrs at 90°C in a loosely capped 15ml centrifuge tube (VWR ...
-
No products found
because this supplier's products are not listed.
Skye R.S. Fishbein, et al.,
bioRxiv - Microbiology 2019
Quote:
... One microgram of each of the fractions was injected on a 75um ID Picofrit column (New Objective, Woburn, MA) packed with Reprosil-Pur C18-AQ 1.9um beads (Dr ...
-
No products found
because this supplier's products are not listed.
Natalia Gebara, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and 2% Chang Medium C (Irvine Scientific), 20% Fetal Calf Serum (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Madeline R. Sponholtz, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... then stained with 2% methylamine tungstate (Nano-W, Nanoprobes) and air dried ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Dmt = 2’,6’-dimethylthyrosine) and SS20 (Phe-D-Arg-Phe-Lys-NH2) were obtained from Biomatik (https://www.biomatik.com). SS31 and SS20 were administered intraperitoneally to APP/PS1 Tg and non-transgenic littermate mice (5mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
Jamilla Akhund-Zade, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
The MA and FL traps were created by cutting an approximately 2 inch-square flap into an empty one-gallon plastic ethanol jug (Koptec, Decon Labs) and baiting them with a fruit and wine mixture ...
-
No products found
because this supplier's products are not listed.
Mathieu Paquette, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cells were incubated for 2 h in medium containing one of the following reagents: Dimethyl sulfoxide (DMSO) (0.1%) (Bioshop Canada, DMS666), Torin1 (1 μM ...
-
No products found
because this supplier's products are not listed.
Isabella Vlisidou, et al.,
bioRxiv - Microbiology 2019
Quote:
... were added to one BioPORTER tube (Genlantis) and resuspended in 920 μl of DMEM ...
-
No products found
because this supplier's products are not listed.
Yuka Sakata, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antigens were retrieved using HistoVT One (Nacalai USA) for 20 min at 70 °C and washed in PBS for 10 min at room temperature ...
-
Recombinant Antigen
Cat# REC31676-100,
100µg USD $837.0
Ask
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Rashmi Chandra, et al.,
bioRxiv - Neuroscience 2023
Quote:
... loaded with one zirconia silica bead (2.3 mm, OPS Diagnostics) per well ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Ashley Maynard, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... + 6% FBS (Omega Scientific, Inc, FB-11) and spun in the centrifuge at 500xg for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Daniel P Myatt, et al.,
bioRxiv - Biophysics 2022
Quote:
... (6) using plasmid DNA purchased from Aldevron, UK with the reaction optimised as per the design-of-experiment (DOE ...
-
No products found
because this supplier's products are not listed.
A.K. Sulit, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 2/1/56 FAA), and Porphyromonas asaccharolytica (CC44 001F, and CC1/6 F2) using Bacterial Lipopolysaccharides (LPS) Extraction Kit (Alpha Diagnostic International, Catalog # 1000-100-LPS) as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kathrin Frey, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All-in-one ready-to-use (Cell Applications Inc, 211A-500) without antibiotics.
-
No products found
because this supplier's products are not listed.
Daniel Spakowicz, et al.,
bioRxiv - Genomics 2019
Quote:
... RNA was purified using the All-in-One purification kit (Norgen Biotek) and its integrity was assayed by an Agilent bioanalyzer (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
David Z. Bushhouse, Julius B. Lucks,
bioRxiv - Molecular Biology 2022
Quote:
... using EconoSpin® All-in-One mini spin columns (Epoch Life Science). IVT linear template was eluted from spin columns using 50 μL UltraPure™ DNase/RNase-Free Distilled Water (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Maitreyi S. Joshi, et al.,
bioRxiv - Systems Biology 2022
Quote:
... atto-590azide (6 mM, ATTO-TEC GmbH, Siegen, Germany) dissolved in DMSO was mixed with aqueous solution of click-chemistry grade CuSO4 (40mM ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP) was obtained from Moravek biochemicals ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
Pinja Kettunen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM Xav939 (BioGems).
-
No products found
because this supplier's products are not listed.
Chamandi S. Dampalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... SARS-CoV-2 3CLpro complex with compound 2: Index HT screen (Rigaku Reagents) condition G8 (25% (w/v ...
-
No products found
because this supplier's products are not listed.
Marie-Françoise Montaron, et al.,
bioRxiv - Neuroscience 2020
Quote:
One-of-ten series was incubated with a rat monoclonal anti-BrdU antibody (1/200, Accurate Chemical) and with a mouse monoclonal anti-NeuN antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Ruhul Amin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 6-well plates with elastic moduli of 0.2 kPa (considered soft) was purchased from Matrigen. Regular 6-well tissue culture dishes were used to represent stiff matrices (elastic moduli is >GPa) ...
-
No products found
because this supplier's products are not listed.
Dimitrios Papagiannidis, et al.,
bioRxiv - Cell Biology 2021
Quote:
... One-hundred microliters of each sample was transferred into 96 well glass bottomed microtiter plates (Brooks Life Sciences, Chelmsford, Massachusetts) coated with concanavalin A and allowed to attach ...
-
No products found
because this supplier's products are not listed.
Xingjie Ren, et al.,
bioRxiv - Genomics 2021
Quote:
... Samples were washed twice with Buffer 2 and resuspended in 50 µl Buffer 2 with antibody (antibodies-online Inc. ...
-
No products found
because this supplier's products are not listed.
Yifei Cai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... human iPSCs maintained in 6-well-plates were harvested by incubating in Accutase (Innovative Cell Technologies AT104) 1 mL/per well plus 10 µM ROCK inhibitor THX (RI)(Tocris #1254 ...
-
No products found
because this supplier's products are not listed.
Biliana Marcheva, et al.,
bioRxiv - Cell Biology 2021
Quote:
... RNA was extracted from Beta-TC-6 cells and pseudoislets using Tri Reagent (Molecular Research Center, Inc, Cincinnati, OH) and frozen at ™80°C ...
-
No products found
because this supplier's products are not listed.
Alison C. Leonard, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS ...
-
No products found
because this supplier's products are not listed.
Ryosuke Munakata, et al.,
bioRxiv - Plant Biology 2020
Quote:
... a TSK gel ODS-80Ts column (2 mm × 250 mm, Tosoh) and a linear gradient program composed of 20% to 80% (v/v ...
-
No products found
because this supplier's products are not listed.
Sandeep Ameta, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... DNA/RNA oligonucleotides (Supplementary File 2) were obtained from IDT DNA technologies.