-
No products found
because this supplier's products are not listed.
Scot P. Ouellette, et al.,
bioRxiv - Microbiology 2022
Quote:
... 1mM glucose-6-phosphate (Moltox), and 10nM aTc ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... (6) was purchased from GenTarget Inc.
-
No products found
because this supplier's products are not listed.
J. Ignacio Gutiérrez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 100 uM Gal4–VP16 (Protein One, P1019-02) and 100 uM ATP or AMP-PNP ...
-
No products found
because this supplier's products are not listed.
Krista L. Newell, et al.,
bioRxiv - Immunology 2021
Quote:
... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
No products found
because this supplier's products are not listed.
Jiling Feng, Yuexun Tang, Wenwei Fu, Hongxi Xu,
bioRxiv - Cell Biology 2023
Quote:
... RT-PCR was performed with a one-step real time PCR using KAPA SYBR FAST One-Step qRT-PCR Universal (D-MARK Biosciences). Primers were used as previously described [18] ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Pirunthan Perampalam, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cytokeratin (human specific cytokeratin 7 and 8, ZETA Corporation #Z2018ML, 1:200), EpCAM (Cell Signaling Technologies ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Yedan Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... One fiber-optic probe (91-00124, Perimed Inc., Las Vegas, NV) coupled with a laser-Doppler flowmeter (LDF ...
-
No products found
because this supplier's products are not listed.
Snježana Kodba, et al.,
bioRxiv - Cell Biology 2024
Quote:
... one well of an 8-well Ibidi chambers (IBI Scientific #80807) was coated with 10 mg/mL Laminin (Sigma ...
-
No products found
because this supplier's products are not listed.
Sylwia Machcinska, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Inc.)-conjugated cytokeratin 6 (CK6; NSJ Bioreagents, Cat # V2168) antibodies ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Haley N. Bridge, Clara L. Frazier, Amy M. Weeks,
bioRxiv - Biochemistry 2023
Quote:
... Azide-SS-biotin (6) was purchased from Broadpharm. Biotin-Diazo-azide (9) ...
-
No products found
because this supplier's products are not listed.
Qian Wu, et al.,
bioRxiv - Pathology 2022
Quote:
... At confluency (∼7 days) RPTEC were exposed to hemin (10µM, Frontier Scientific, #FSIH651) in serum-free RPTEC media for the indicated times.
-
No products found
because this supplier's products are not listed.
Murat Artan, et al.,
bioRxiv - Biochemistry 2022
Quote:
One ml of PureCube Ni-NTA agarose resin slurry (Cube Biotech, Germany) was transferred to a 15 ml Falcon tube ...
-
No products found
because this supplier's products are not listed.
Jijin R. A. Kuttiyatveetil, et al.,
bioRxiv - Biochemistry 2021
Quote:
... EPA 200.7 standard 6 purchased from High-Purity Standards was used for calibration ...
-
No products found
because this supplier's products are not listed.
Sebastian Müller, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and ECM 6-well plates (Celprogen, #E36102-29-6Well). Primary human T-cells were cultured in RPMI 1640 medium (Gibco ...
-
No products found
because this supplier's products are not listed.
In-Hyuk Jung, et al.,
bioRxiv - Genetics 2020
Quote:
... 50 µg ml-1 human medium oxidized low density lipoprotein (oxLDL, #770202-7, Kalen biomedical) was used.
-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2023
Quote:
... 6-8×105 primary mouse or human (obtained from BioIVT) hepatocyte cultures were infected with 2-4×104 sporozoites in each well of a 6-well plate ...
-
No products found
because this supplier's products are not listed.
Nadejda Bozadjieva Kramer, et al.,
bioRxiv - Physiology 2020
Quote:
Insulin levels (6-hour fasting) were measured with ELISAs (Crystal Chem) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Orsolya Németh-Szatmári, et al.,
bioRxiv - Molecular Biology 2022
Quote:
6 × 105 cells/flask were seeded into T25 cell culture flasks (Biologix, Jinan, Shandong, China) and left to grow for 24 h ...
-
WB, ELISA
Cat# CDC-53,
0.05 mg, Inquire
Ask
Konner Cool, et al.,
bioRxiv - Microbiology 2021
Quote:
... VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2)7 were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration ...
-
No products found
because this supplier's products are not listed.
Ghanshyam P. Sinha, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sucrose-aCSF from one lateral side to the other side using a vibrating microtome (7000smz-2; Campden Instruments, Lafayette, IN, USA). All slices were incubated for 15 min at room temperature in recovery solution that contained (in mM) ...
-
No products found
because this supplier's products are not listed.
Kärt Mätlik, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The cerebella were soaked in the DNA for 15-20 minutes on ice and were transferred one at a time into the well of an electroporation chamber (Protech International Inc ...
-
No products found
because this supplier's products are not listed.
P. Baumert, et al.,
bioRxiv - Physiology 2020
Quote:
... were placed along the sagittal axis over the muscle belly at 33% of the respective muscle length from the distal end [according to SENIAM guidelines 58] and one reference electrode (Ambu Blue, Ambu, Copenhagen, Denmark) was positioned over the medial tibial condyle ...
-
No products found
because this supplier's products are not listed.
Jixing Li, Marco Lai, Liina Pylkkänen,
bioRxiv - Neuroscience 2023
Quote:
... This task differed from the prior minimal composition studies which have only used one matching or mismatching task picture (Bemis & Pylkkanen, 2011). The reason for our larger set of pictures was that this decreased the chance of an accurate response by chance ...
-
No products found
because this supplier's products are not listed.
Lior Tal, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Arabidopsis KAI2 protein was expressed as a 6× His-SUMO fusion protein using the expression vector pSUMO (LifeSensors). His-SUMO-KAI2 was isolated from by Ni-NTA resin and the eluted His-SUMO KAI2 was further separated by anion-exchange ...
-
No products found
because this supplier's products are not listed.
Elisa Nerli, et al.,
bioRxiv - Developmental Biology 2022
Quote:
Fixed samples were imaged with a laser-scanning microscope (Zeiss LSM 880 Airyscan inverted or Zeiss LSM 980 Airyscan2 inverted, equipped with two PMT and one GaAsP) using the 40×/1.1 C-Apochromat water immersion objective (ZEISS) ...
-
No products found
because this supplier's products are not listed.
David Forgacs, et al.,
bioRxiv - Immunology 2021
Quote:
... IgG equivalent concentrations were calculated based on a 7-point standard curve generated by a human IgG reference protein (Athens Research and Technology, Athens, GA, USA), and verified on each plate using human sera with known concentrations.
-
Creative-Proteomics Rat AKI Glass protein array, detected 7 Rat proteins. Suitable for variety...
Cat# RG-APA-CPG,
inquiry, contact supplier for pricing
Ask
J. M. Kirkland, et al.,
bioRxiv - Neuroscience 2023
Quote:
Homogenate from two sex- and manipulation-matched rats were pooled into one sample for proteomic analysis carried out by Creative Proteomics (https://www.creative-proteomics.com/).
-
No products found
because this supplier's products are not listed.
Callie P. Wigington, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5-6 mg of lysate was used for pull-downs with 30 μl of GFP-Trap magnetic beads (Bulldog Bio. Inc.) in binding buffer (50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Steven D. De Michino, et al.,
bioRxiv - Genomics 2023
Quote:
... a predetermined quantity (10-300 ng SU-DHL-6 cfDNA) was diluted in RPMI 1640 (Wisent Bioproducts, CAT #350-000-CL) and subjected to ChIP-Seq adapted from Sadeh et al21 ...
-
No products found
Pei Xuan Lee, et al.,
bioRxiv - Microbiology 2020
Quote:
... were immunized intraperitoneally (ip) thrice (week 0, 2 and 6) with 20 μg of hexameric NS1 from DENV2 16681 strain (The Native Antigen Company) or OVA protein (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
Anti-RNP was detected in female 52 week old C57Bl/6 and 32-52 week old NZM2328 mice (harvested at time of nephritis or at 52 weeks) via ELISA (Alpha Diagnostics, San Antonio, TX) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
L Pérez-Sisqués, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mice sacrificed one week after behavioral testing with FD Rapid GolgiStain™kit (FD Neurotechnologies) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Silvia J. Park, et al.,
bioRxiv - Neuroscience 2023
Quote:
... eyecups were rinsed twice in PBS and embedded in 7% low-melt agarose (Precisionary, SKU VF-AGT-VM). The agarose-embedded eyecups were Vibratome-sectioned into 100 µm-thick slices (VT1200 ...
-
No products found
because this supplier's products are not listed.
Jun Noguchi, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 4-Methoxy-7-nitroindolinyl (MNI)-glutamate or 4-carboxymethoxy-5,7-dinitroindolinyl (CDNI)-glutamate was custom-synthesized by Nard institute Ltd ...
-
No products found
because this supplier's products are not listed.
Nicole Wagner, Mark P. Foster,
bioRxiv - Biochemistry 2021
Quote:
... pH 7) to a concentration of 25 μM and placed into a 1 mm path length quartz cuvette (Starna Cells). NMR buffer with no DNA was used as a blank ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Zachery Mielko, et al.,
bioRxiv - Biophysics 2022
Quote:
... Primary antibodies for CPD and 6-4PP photoproducts were purchased from Cosmo Bio USA (Catalog numbers ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Josée Perreault, et al.,
bioRxiv - Immunology 2020
Quote:
... The plates were incubated once again for one hour at RT followed by washing and addition of 100 μl of 3,3’,5,5’-Tetramethylbenzidine (TMB, ESBE Scientific). The colorimetric reaction proceeded for 20 minutes at RT and was stopped by addition of 100 μl of H2SO4 1N (Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Zhifen Cui, et al.,
bioRxiv - Microbiology 2021
Quote:
... were generated by simultaneously mixing one volume of lipid mixture (25 : 5: 19.3 : 0.8 : 50 molar ratio) of DLin-MC3-DMA (MedKoo Biosciences, #555308), DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine ...
-
No products found
because this supplier's products are not listed.
Mary Kefi, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... After validation of recombinant protein expression of expected size in Sf9 cells and determination of viral stock titers using baculoQUANT ALL-IN-ONE (GenWay), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Fatima Abbas, et al.,
bioRxiv - Neuroscience 2023
Quote:
The mutated toxin AaH-IIR62K was the one described in a previous report [26] and it was produced by Smartox Biotechnology (Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Meilin Zhu, et al.,
bioRxiv - Microbiology 2023
Quote:
... four parts MRS+CQ broth was combined with one part Cleanascite™ Lipid Removal Reagent (Biotech Support Group #X2555-10) and shaken (220 rpm ...