-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 6 or 7 of embryoid body culture (Extended Data Fig. 4) was done using Imaris (version 9.1.2, Oxford Instruments). Intensity of transcription spots were quantified using the ‘Spots’ tool calculated as the mean of pixels within an ovoid shape of 1 μm x 1 μm x 3 μm in size (x,y,z dimensions respectively) ...
-
No products found
because this supplier's products are not listed.
Abdulbasit Amin, et al.,
bioRxiv - Physiology 2022
Quote:
Blood was collected from 6 – 7 h fasted mice to quantify the concentration of insulin in the serum using an insulin ELISA kit (ALPCO). The medium of adipocytes was cleared and used to evaluate the levels of TNF ...
-
No products found
because this supplier's products are not listed.
Alec T Beeve, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The silicon cuff was placed around the nerve and closed with one stitch of 6-O nylon suture (McKesson, REF S1698GX), and the receiver was placed subcutaneously proximal to the cuff ...
-
No products found
because this supplier's products are not listed.
Hongxu Dong, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Slow release fertilizer was applied to each pot (Osmocote Pro 17-5-11, 6 months; 35 g per 7 L pot and 140 g per 17 L pot; ICL Specialty Fertilizers, Dublin, OH, USA). Drip irrigation was supplied to each pot automatically twice per day ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and 10ng/mL IL-7 (Tonbo Biosciences, 218079U002). Stimulated PBMCs were electroporated using the Neon transfection system (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Samuel G. Nonis, et al.,
bioRxiv - Biochemistry 2020
Quote:
... pH 7 from the ProPlex crystallisation screen (Molecular Dimensions). An additive screen was then performed using the sitting-drop vapour diffusion method with 30 μL of reservoir solution (125 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Nicole M Sodir, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rat monoclonal anti-neutrophils (Clone 7/4, Cedarlane, CL8993AP), rat monoclonal F4/80 (clone Cl:A3-1 ...
-
No products found
because this supplier's products are not listed.
Sofian N. Obaid, et al.,
bioRxiv - Bioengineering 2022
Quote:
... A 7 μm thick SU-8 2007 (MicroChem Corp.) was spin coated on the PET film at 3,000 rpm for 40 s ...
-
No products found
because this supplier's products are not listed.
Chima V. Maduka, et al.,
bioRxiv - Bioengineering 2022
Quote:
... IL-6 ELISA kits (RayBiotech) for supernatants were used according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... proSAAS (AAV 2/6; Vigene Biosciences) or enhanced green fluorescent protein (GFP; AAV 2/6; Vector Biolabs) was driven by the human SYN1 promoter ...
-
No products found
because this supplier's products are not listed.
Reza Nejat, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ubiquitin−7-amino-4-methylcourmarin (Ub-AMC) was purchased from Boston Biochem; human ISG15−7-amino-4-methylcourmarin (ISG15-AMC ...
-
No products found
because this supplier's products are not listed.
Yurika Matsui, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Resolving gels: 6-12% ProtoGel (National Diagnostics EC8901LTR), 0.375 M Tris-HCl (pH 8.8) ...
-
No products found
because this supplier's products are not listed.
Olivia D. Nigro, et al.,
bioRxiv - Microbiology 2021
Quote:
... mixed cellulose ester filters (47 mm, GN-6; Pall) and filters were placed face-up on the vibrio-selective medium CHROMagar Vibrio (DRG Intl.) ...
-
No products found
because this supplier's products are not listed.
Cecilia Webber, et al.,
bioRxiv - Microbiology 2024
Quote:
... Sub-fraction 7 (25 mg) was subjected to reversed-phase semi-preparative HPLC (Phenomenex Luna C18 (2), 250 × 10 mm ...
-
No products found
because this supplier's products are not listed.
Noel M. Lacerna II, et al.,
bioRxiv - Microbiology 2020
Quote:
... (±) trans-12,13-Epoxy-octadecanoic acid (6) and 12(Z)-octadecenoic acid (7) were purchased from Larodan Fine Chemicals (Solna ...
-
FOXM1 inhibitor
Sold for research purposes only.
Cat# 2384.0, SKU# 2384-50 mg,
50mg, US $324.50 / EA, EURO, €295 / EA
Ask
Anne Margriet Heijink, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 7 nM talazoparib (Axon Medchem), 50 nM mitomycin C (Sigma) ...
-
No products found
because this supplier's products are not listed.
Hataf Khan, et al.,
bioRxiv - Microbiology 2020
Quote:
... KPNA1-6 (ABclonal), KPNB1 (ABclonal) ...
-
No products found
because this supplier's products are not listed.
Ami Vadgama, et al.,
bioRxiv - Immunology 2023
Quote:
... 0.3-30μM thrombin-receptor activating peptide 6 (TRAP-6; Cambridge Biosciences); 0.3-30μM U46619 (Enzo Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Raphael A. Reyes, et al.,
bioRxiv - Immunology 2024
Quote:
... One hundred fifty µL blocking buffer (one-third Non-Animal Protein (NAP)-Blocker (G-Biosciences #786-190P) and two-thirds PBS ...
-
LC Laboratories' Product Number S-7979 - SP600125 (Anthra(1,9-cd)pyrazol-6(2H)-one,...
Cat# S-7979, SKU# S-7979_2g,
2 g, $495.00
Ask
Josh Tycko, et al.,
bioRxiv - Systems Biology 2023
Quote:
... in one well 100 nM Rapamycin (LC Laboratories) was added and the other well contained regular RPMI complete media ...
-
No products found
because this supplier's products are not listed.
Félix Velando, et al.,
bioRxiv - Microbiology 2024
Quote:
... One-microliter capillary tubes (P1424, Microcaps; Drummond Scientific) were heat-sealed at one end and filled with either the chemotaxis buffer (negative control ...
-
No products found
because this supplier's products are not listed.
Nicholas R Saichek, et al.,
bioRxiv - Microbiology 2021
Quote:
Glucose (CAS 50-99-7) was from Amresco (Solon, OH). 13C-glutamine (C5-99%) ...
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-6 (Lot: 449268JEI6, Elabscience, China), and IL-10 (Lot ...
-
No products found
because this supplier's products are not listed.
Méghane Sittewelle, Stephen J. Royle,
bioRxiv - Cell Biology 2023
Quote:
... 6 mM of 2-deoxyglucose (Apexbio) and 10 mM of sodium azide (G-Biosciences ...
-
No products found
because this supplier's products are not listed.
Tristan Lerbs, et al.,
bioRxiv - Immunology 2020
Quote:
We used a One Step Trichrome Stain Kit (American MasterTech). After deparaffinization and rehydration ...
-
No products found
because this supplier's products are not listed.
Mariya B Shapiro, et al.,
bioRxiv - Immunology 2023
Quote:
One alpaca was immunized with PSMA-His protein (Sino Biological) and CFA/IFA adjuvant administered every 21 days over the study period ...
-
No products found
because this supplier's products are not listed.
Ria Lassaunière, et al.,
bioRxiv - Immunology 2023
Quote:
... A 100 μL TMB One Substrate (Cat. # 4380, KemEnTec, Denmark) was added and incubated for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Azlann Arnett, et al.,
bioRxiv - Immunology 2021
Quote:
... and 6 μl 5M NaCL (Active Motif) for 30 minutes at 37°C followed by 2 μl proteinase K (Active Motif ...
-
No products found
because this supplier's products are not listed.
Daniel A. Pensinger, et al.,
bioRxiv - Microbiology 2022
Quote:
... difficile agar base (Oxoid) supplemented with 7% defibrinated horse blood (HemoStat Laboratories), 32 mg/L moxalactam (Santa Cruz Biotechnology) ...
-
No products found
because this supplier's products are not listed.
Austin T. Baldwin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... one dorsal blastomere was injected with 1ng Cas9 protein (PNA Bio), 250pg shroom3-targeted sgRNA (target sequence GUAGCCGGAGAGAUCACUUG ...
-
No products found
because this supplier's products are not listed.
Ludovic Gaut, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... or 6-wells Uniflex Flexcell plates (FlexCell Int) made of silicone substrate coated with type I collagen ...
-
No products found
because this supplier's products are not listed.
Sarah M. Glenn, et al.,
bioRxiv - Microbiology 2023
Quote:
... C57BL/6 wild type and iNOS knockout mutant (Kerafast) cell lines were grown at 37°C with 5% CO2 in Dulbecco’s Modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Kanve N. Suvilesh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK5/6 (mouse, ACR 105, 1:100; Biocare Medical), thyroid transcription factor (TTF-1 ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Ji Wang, et al.,
bioRxiv - Pathology 2021
Quote:
... 5-7 μL were injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu ...
-
No products found
because this supplier's products are not listed.
Ningning Zhang, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Each sample was aliquoted and one of them was added with ascorbate (Thomas Scientific LLC, C988F55) to a final concentration of 100 mM ...
-
No products found
because this supplier's products are not listed.
Shijie Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
Di-docosahexaenoyl (22:6) bis (monoacylglycerol) phosphate (di-22:6-BMP) was measured in plasma and exosome-depleted urine and CSF by ultra-performance liquid chromatography – tandem mass spectrometry (UPLC-MS/MS) ...
-
No products found
because this supplier's products are not listed.
Benjamin S. O’Brien, et al.,
bioRxiv - Cell Biology 2021
Quote:
... containing 7% fetal bovine serum (FBS) (Atlanta Biologicals) and 1% penicillin-streptomycin (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Bryan Gutierrez, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3-azido-7-hydroxycoumarin was purchased from Biosynth International Inc ...
-
No products found
because this supplier's products are not listed.
Zezhong Zheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
Gene editing of COS-7 cells were performed by electroporation of COS-7 cells with Super PiggyBac plasmid (PB210PA-1, System Biosciences) and one of the 5 plasmids of pBv1-EF-6X ...
-
No products found
because this supplier's products are not listed.
Joseph M. Varberg, et al.,
bioRxiv - Cell Biology 2020
Quote:
... pombe cDNA library (AS One International, Inc.) using KOD Hot Start DNA polymerase (Millipore Sigma) ...
-
No products found
because this supplier's products are not listed.
Yuka Sakata, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Antigens were retrieved using HistoVT One (Nacalai USA) for 20 min at 70 °C and washed in PBS for 10 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Qixiang He, et al.,
bioRxiv - Biochemistry 2021
Quote:
One or two liters of Trichoplusia (Tni) cells (Expression System) were infected with recombinant baculoviruses at a cell density of 1.5-2.0 × 106 cells per mL ...
-
No products found
because this supplier's products are not listed.
Gloria Somalo-Barranco, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... and automated with Isolera™ One with UV-Vis detection (Biotage).
-
No products found
because this supplier's products are not listed.
Maximilian Lenz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and TTX (0.5 μM; Biotrend #18660-81-6) were added to the external solution ...
-
No products found
because this supplier's products are not listed.
Martin Thunemann, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A tungsten extracellular microelectrode (FHC, 6-8 MΩ) was used to determine the location of the C1 whisker representation on the whisker-barrel cortex prior to electrode array placement ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Koji Ohira, et al.,
bioRxiv - Neuroscience 2019
Quote:
... One group was treated with FLX pellets (Innovative Research of America, Sarasota, FL) for 4 weeks at a dose of 3 mg/kg/day ...
-
No products found
because this supplier's products are not listed.
Guillem Casadevall, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Crystals appeared within one day from the Index HT screen from Hampton Research Inc ...
-
No products found
because this supplier's products are not listed.
Xiaodong Duan, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Each drive was loaded with closely aligned one optical fiber (230 um, RWD Life Science) and 4 tetrodes ...