-
No products found
because this supplier's products are not listed.
Cassidy S. Cornblatt, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 1:2500 for α-calnexin (CNX1/2, Agrisera), 1:1000 for goat-α-mouse-HRP (AP124P ...
-
No products found
because this supplier's products are not listed.
Rianna Vandergaast, et al.,
bioRxiv - Immunology 2020
Quote:
... mouse α-SARS-CoV-2 spike antibody (GeneTex #GTX632604), affinity-purified polyclonal α-human-Ace-2 antibody (R&D Systems #AF933) ...
-
No products found
because this supplier's products are not listed.
Joel Johnson George, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... X-gal (5-Bromo-4-chloro-3-indoxyl-beta-D-galactopyranoside, Goldbio) was dissolved in dimethylformamide at 50 mg/ml ...
-
No products found
because this supplier's products are not listed.
Howard J. Teresinski, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Membranes were incubated with primary antibody for one hour (α-CLuc; Santa-Cruz Biotech) at room temperature or overnight at 4°C (α-His; GenScript), followed by washes with TBS-T ...
-
No products found
because this supplier's products are not listed.
Tirumalasetty Muni Chandra Babu, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... MTT (3-[4, 5- dimethyl thiazol-2-yl]-2,5 diphenyl tetrazolium bromide) (Alfa Aesar Chemicals Co. Ltd. Shanghai, China), fetal bovine serum (FBS ...
-
Cat# HY-N6825-5 mg,
5 mg, USD $295.0
Ask
Irina V. Mikheyeva, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cells were stained with 300 µM 3-[[(7-Hydroxy-2-oxo-2H-1-benzopyran-3-yl)carbonyl]amino]-D-alanine hydrocholoride (HADA, MedChemExpress, Cat. #HY-131045/CS-0124027) and perfused with 0.85X PBS prior to the osmotic shock.
-
No products found
because this supplier's products are not listed.
Yeon Soo Kim, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
No products found
because this supplier's products are not listed.
Alexander J. Stemm-Wolf, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1:2000 α-SAS-6 (Bethyl A301-802A); 1:500 α-CPAP (Proteintech CENPJ 11517-1-AP) ...
-
No products found
because this supplier's products are not listed.
Wadie D. Mahauad-Fernandez, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... α-PD-1 (BioXCell Clone RMP1-14 and catalog number BE0146) ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
... CD38 APC-AF700 (clone LS198-4-3; Beckman Coulter), CD19 APC-Cy7 (clone SJ25C1 ...
-
No products found
because this supplier's products are not listed.
Sunniyat Rahman, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
No products found
because this supplier's products are not listed.
Elizabeth T. Wiles, et al.,
bioRxiv - Genetics 2021
Quote:
H3K27me2/3 ChIP using α-H3K27me2/3 antibody (Active Motif, 39536), which recognizes di- or trimethylated H3K27 ...
-
No products found
because this supplier's products are not listed.
Gang Ye, et al.,
bioRxiv - Microbiology 2020
Quote:
Male C57BL/6 mice (3 to 4 weeks old) (Envigo) were intravenously injected (tail-vein ...
-
No products found
because this supplier's products are not listed.
Cristina Esteva-Font, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... DAPI (4’,6-diamidino-2-phenylindole, MP Biomedicals, Solon, OH) was added at 300 nM for 15 min ...
-
No products found
because this supplier's products are not listed.
Yang Liu, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... and incubated with 4′,6-diamidino-2-phenylindole (Solarbio, #C0065) for 10 min ...
-
No products found
because this supplier's products are not listed.
Han Zhu, et al.,
bioRxiv - Cell Biology 2022
Quote:
Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Lucas Bayonés, et al.,
bioRxiv - Neuroscience 2024
Quote:
... stained with 5 mg/ml 4′,6-diamidino-2-phenylindole and visualized using a Nikon C1 Plus laser-scanning confocal microscope (Nikon, Tokyo, Japan). All images were captured at the equatorial plane of the cells ...
-
No products found
because this supplier's products are not listed.
Sriram Narayanan, et al.,
bioRxiv - Immunology 2020
Quote:
NK cells were expanded by culturing with IFN-α and IL-2 (Miltenyi Biotec) in cIMDM for 48 hours to induce priming ...
-
No products found
because this supplier's products are not listed.
Enrico Amato Jr, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... goat-α-RFP (1:1000, Rockland), SW rabbit-α-GnRH-1 (1:6000 ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... BTLA (BTA-H5255; Acrobiosystems), ICOS (ICS-H5258 ...
-
No products found
because this supplier's products are not listed.
Trinovita Andraini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3-(2,4-Dichloro-5-methoxyphenyl)-2-sulfanyl-4(3H)-quinazolinone (BML-CM127-0050, Enzo Life Sciences) was injected at 20mg/kg (in 10% DMSO ...
-
No products found
because this supplier's products are not listed.
Luke A Johnson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... In all patients a directional “1-3-3-1” electrode was used (4/5 patients: Abbott Infinity model 6172 ...
-
No products found
because this supplier's products are not listed.
Michelle Wantoch, et al.,
bioRxiv - Immunology 2020
Quote:
... 96 well plates were coated with a mixture of antibodies against IFN-α (Mabtech, MT1/3/5) overnight at 4°C ...
-
Prepared to contain lower tryptic activity levels to limit damage to membrane proteins and...
Cat# LS004191,
Bulk, Inquire
Ask
Chunlei Cang, Boxun Lu, Dejian Ren,
bioRxiv - Physiology 2020
Quote:
... 4 mg collagenase type 2 (Worthington) and 1.5 mg trypsin (Worthington) ...
-
No products found
because this supplier's products are not listed.
Kun Zhao, et al.,
bioRxiv - Biophysics 2019
Quote:
An aliquot of 4 μl of 6 μM Ac-E46K α-syn fibril solution was applied to a glow-discharged holey carbon grid (Quantifoil R1.2/1.3, 300 mesh), blotted for 6.5 s ...
-
No products found
because this supplier's products are not listed.
Joshua Greig, et al.,
bioRxiv - Cell Biology 2024
Quote:
... α-mouse 680RD and α-rabbit 800CW (LI-COR Biosciences) at a dilution of 1:10,000 ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Piyush Daga, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4% (3-Aminopropyl)triethoxysilane(APTES)-treated and 2% glutaraldehyde-activated glass-bottom dishes (Ibidi) were used to cast polyacrylamide (PAA ...
-
No products found
because this supplier's products are not listed.
Mingrong Zuo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... total-JNK1/2/3 (Abclonal #A4867), CCL2/MCP1 (Abclonal # A23288).
-
No products found
because this supplier's products are not listed.
Dominik Schumacher, et al.,
bioRxiv - Microbiology 2020
Quote:
... α-PilC (1:3000)50 or α-mCh (1:5000; Biovision) primary antibodies together with horseradish-conjugated goat α-rabbit immunoglobulin G (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
J. Christopher Rounds, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sonicated for 3×5 minutes in a 4°C Bioruptor ultrasonicator (UCD-200, Diagenode), vortexed ...
-
No products found
because this supplier's products are not listed.
Natalia Benetti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3 and 4 by lysing cells in the 6-well plate in RNA lysis buffer (Zymo) and freezing at −80 °C until extraction ...
-
No products found
because this supplier's products are not listed.
Jérôme Montnach, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Low resistance borosilicate glass pipettes (2-3 MΩ; Sutter Instruments) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Stefano Cattaneo, et al.,
bioRxiv - Neuroscience 2019
Quote:
All drugs were obtained from Sigma except 2,3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide disodium salt (NBQX) and 2-(3-carboxypropyl)-3-amino-6-(4 methoxyphenyl)pyridazinium bromide (gabazine) which were obtained from Hello Bio (Bristol, UK).
-
No products found
because this supplier's products are not listed.
Taylor Hart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 95% 4-methyl-3-hexanol was purchased from Enamine (CAS# 615-29-2), and paraffin oil from Hampton Research (cat ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Yohan S.S. Auguste, et al.,
bioRxiv - Neuroscience 2022
Quote:
... subcutaneous] before being anesthetized using isoflurane (SomnoSuite, Kent Scientific; 3-5% induction, 1-2% maintenance). Once anesthetic depth was achieved ...
-
No products found
because this supplier's products are not listed.
Ugo Tomasello, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... Cortical layers 2/3 and 4 neurons were visualized by using an upright microscope and camera system (BX51WIF, Olympus, and SciCam Pro CCD camera ...
-
No products found
because this supplier's products are not listed.
Martin Baccino-Calace, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Larvae were dissected and sharp-electrode recordings were made from muscle 6 in abdominal segments 3 and 4 using an Axoclamp 900A amplifier (Molecular Devices). The extracellular HL3 saline contained (in mM) ...
-
No products found
because this supplier's products are not listed.
Lara Schmitz, Melina Ayaka Schwier, Kai Heimel,
bioRxiv - Genetics 2019
Quote:
... or α-RFP [G6G] (Chromotek, 1:1000) antibodies were used to detect respective fusion proteins ...
-
No products found
because this supplier's products are not listed.
Nathan D. Lord, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 1:1000 α-GFP antibody (Aves Labs AB_2307313) in antibody binding buffer at 4ºC ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Mai M. Abdelmoaty, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant human IFN-α (PBL Assay Science, 11200-2) was used as assay standard ...
-
No products found
because this supplier's products are not listed.
Tori Tonn, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... glass slides (4’’ by 3’’; Ted Pella) and the feature-side of the PDMS slabs were thoroughly cleaned with tape to remove any dust particles ...
-
No products found
because this supplier's products are not listed.
Camille Mazo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... An array of 4 tungsten electrodes (∼3 MΩ; FHC) was glued together and was slowly lowered into the OB ...
-
No products found
because this supplier's products are not listed.
Sabine Schmidt, et al.,
bioRxiv - Cell Biology 2023
Quote:
... goat α-mouse (1:2000) (Dianova) and donkey α-rabbit (1:2000 ...
-
No products found
because this supplier's products are not listed.
S.M. Kamel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Pipettes (resistance 3–4 MΩ) were pulled from borosilicate glass capillaries (Harvard Apparatus, UK) using a custom-made microelectrode puller ...
-
No products found
because this supplier's products are not listed.
Jeroen van den Berg, et al.,
bioRxiv - Cell Biology 2019
Quote:
... a Lionheart FX automated microscope in combination with sirDNA77 staining was used to generate growth curves with a time resolution of 4 hours for a total time span of 136 hours (microscope maintained at 37°C, 5% CO2 using a 4× lens and a Sony CCD, 1.25 megapixel camera with 2 times binning; BioTek). Quantification of cell number was performed by Gen5 software (BioTek).