-
No products found
because this supplier's products are not listed.
Anna E. Boczula, et al.,
bioRxiv - Microbiology 2021
Quote:
... or whole medium containing 1% dimethyl sulfoxide (DMSO; Bioshop Canada, Burlington, ON) and 20% heat-inactivated FBS ...
-
No products found
because this supplier's products are not listed.
Patricia C. Lopes, Robert de Bruijn,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... Tissue homogenization was done by agitating the tubes for 20□s at a 7□m□s−□1 speed (Beadbug 6 homogenizer, Benchmark Scientific), followed by a 5□min rest period ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Angélica Díaz-Basabe, et al.,
bioRxiv - Immunology 2023
Quote:
... STAT-3 (1:600, E-Ab-40131, Elabscience, Houston, Texas, USA); GSK-3ab (1:500 ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Jessica B. Sarthi, et al.,
bioRxiv - Physiology 2023
Quote:
... Mice were anesthetized with oxygen-delivered isoflurane (1-3%) at 1 L/min via a vaporizer (Braintree Scientific, Inc, Braintree, Mass). Mouse temperature was monitored by rectal probe and maintained at 37°C through automated warming using a controlled warming pad (ATCC 2000 ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Yuuki Wittmer, et al.,
bioRxiv - Biophysics 2022
Quote:
... ∼6 mL using Millipore Amicon Ultra-15 3 kDa MWCO centrifugal filter and dialyzed (Spectrum Laboratories 1.7 ml/cm standard SpectraPor 1 RC Tubing ...
-
No products found
because this supplier's products are not listed.
Sang Soo Kim, et al.,
bioRxiv - Neuroscience 2019
Quote:
... GT1-7 cells were infected with the retrovirus encoding MC4R-3×HA using ViraDuctin™ Transduction Kit (Cell Biolabs, Inc.) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
Gemma Gou, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Brain tissue was homogenized by 30 strokes in 1-mL or 7-mL borosilicate Dounce homogenizers (glass-Teflon tissue grinder; Wheaton, Millville, NJ) depending on the volume of buffer required ...
-
No products found
because this supplier's products are not listed.
Wenyang Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Blots were washed 3 times with Tris Buffered Saline-Tween (TBST) buffer (Boston BioProducts, Cat. # IBB-181–6) and developed using SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Sai Li, et al.,
bioRxiv - Biophysics 2022
Quote:
... Laminar-flow-separated channels 1-3 were used to form DNA tethers between two 4.35-μm streptavidin-coated polystyrene beads (Spherotech). Channels 4 and 5 served as protein loading and imaging channels ...
-
No products found
because this supplier's products are not listed.
Connor D. Courtney, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and QCapture Pro 7 software (Teledyne Photometrics).
-
No products found
because this supplier's products are not listed.
Audrey Tze Ting Khoo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the same solution containing the primary antibody overnight at 4°C (anti-tRFP, 1:1000, Evrogen; anti-GABA, 1:2000, MilliporeSigma anti-parvalbumin, 1:2000, Abcam; anti-somatostatin, 1:1000, Peninsula Laboratories) (iii ...
-
No products found
because this supplier's products are not listed.
Phuong T. Lam, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Corning)-coated dishes in NIM at an approximate density of 20 aggregates per cm2 and switched to DMEM/F12 (3:1) supplemented with 2% Gem21 NeuroPlex (without vitamin A, Gemini Bio-Products, 400-161), 1X NEAA ...
-
No products found
because this supplier's products are not listed.
Mehran Najibi, et al.,
bioRxiv - Immunology 2019
Quote:
... Anti-Mucolipin 1 (MCOLN1) (C-Term) antibody (Antibodies-Online, ABIN571446 1:1000).
-
No products found
because this supplier's products are not listed.
Iris Lindberg, et al.,
bioRxiv - Neuroscience 2021
Quote:
... proSAAS (AAV 2/6; Vigene Biosciences) or enhanced green fluorescent protein (GFP; AAV 2/6; Vector Biolabs) was driven by the human SYN1 promoter ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... while injections of CTb 1% (low salt, 1%, List Biological Laboratories, Campbell, CA) in distilled water ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Elena V. Kozlova, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The active glucagon-like peptide-1 (7-36) Amide (GLP-1) assay (Cat.# 80-GLP1A-CH01, ALPCO) had an analytical sensitivity of 0.15 pM in a standard range of 0.45-152 pM and inter- and intra-assay CV of 11.6 and 9.5% ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Michael J. Pereira, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 ug-mL-1 Human IgM (Innovative Research), a classical pathway activator ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
No products found
because this supplier's products are not listed.
Yiwei Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
... They were either combined at a 1 : 1 ratio or separately subjected to 3% H2O2 (Spectrum Chemical) and incubated at 37°C with 200rpm shaking for up to 2h ...
-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 6 or 7 of embryoid body culture (Extended Data Fig. 4) was done using Imaris (version 9.1.2, Oxford Instruments). Intensity of transcription spots were quantified using the ‘Spots’ tool calculated as the mean of pixels within an ovoid shape of 1 μm x 1 μm x 3 μm in size (x,y,z dimensions respectively) ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Elizabeth B. Draganova, Ekaterina E. Heldwein,
bioRxiv - Microbiology 2021
Quote:
... a total of 10 μL of GUVs with a 3:1:1 molar ratio of POPC:POPS:POPA containing ATTO-594 DOPE (ATTO-TEC GmbH) at a concentration of 0.2 μg/μL was mixed with 1 μM NEC220 (final concentration) ...
-
No products found
because this supplier's products are not listed.
Victoria Chan, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 7 (Quorum Technologies), where image enhancements were completed without altering the quantitative relationship between image elements ...
-
No products found
because this supplier's products are not listed.
Karen J. Gonzalez, et al.,
bioRxiv - Microbiology 2023
Quote:
... The grid was washed in water twice and then stained with 0.75% uranyl formate (R-1b) or Nano-W (Nanoprobes) (M-104 ...
-
No products found
because this supplier's products are not listed.
Michael Morgan, et al.,
bioRxiv - Biochemistry 2021
Quote:
... We added 29 µM of the enzyme:peptide mixture to 1 mL of 30 µM Ub-AMC (7-amino-4- methylcoumarin) (Boston Biochem), for a final concentration of 200 nM DUBm ...
-
No products found
because this supplier's products are not listed.
Bader M. Jarai, Catherine A. Fromen,
bioRxiv - Bioengineering 2021
Quote:
BMMs in 6-well plates (1×106 cells/well) were detached using Accutase® (Innovative Cell Technologies, Inc.) and washed twice with PBS supplemented with 2% FBS ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Meitham Amereh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Citric acid monohydrate (CAS# 5949-29-1) and sodium citrate (CAS# 6132-04-3) from Bio basic Canada Inc ...
-
No products found
because this supplier's products are not listed.
Rodrigo S. Maeda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... EMG electrodes were made in-house and consisted of Teflon-coated 3 or 7 -strand stainless steel wire with 50 to 100 mm length (A-M Systems, Sequim, WA), threaded into a 30-mm ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Jeremy F Brooks, et al.,
bioRxiv - Immunology 2020
Quote:
Immunogens were admixed 1:1 with Alhydrogel 1% adjuvant (Accurate Chemical and Scientific Corp.) and injected i.p ...
-
No products found
because this supplier's products are not listed.
Marijke I. Zonneveld, et al.,
bioRxiv - Immunology 2020
Quote:
... and 1 µg/ml soluble αCD28 (CLB-CD28/1, 15E8 Sanquin) in the presence or absence of milk EVs or EV depleted control ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Qingtao Sun, et al.,
bioRxiv - Neuroscience 2023
Quote:
Biotinylated human IL-6 solution (Acrobiosystems, IL-6-H8218 ...
-
No products found
because this supplier's products are not listed.
Mari Takalo, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IP-1 ELISA (Cisbio) assay was then used according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nihal Karakaş, et al.,
bioRxiv - Immunology 2023
Quote:
... ß-actin (1: 5000, Abbkine), α-tubulin (1 ...
-
No products found
because this supplier's products are not listed.
Maria Florencia Ercoli, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 1% sucrose (pH 5.8) in 0.3% Gellex (Gellan Gum CAS#71010-52-1 Caisson Laboratories) supplemented with or without 1µM of the selected kinase inhibitor (see Supplemental Table S5 for a description of the compounds tested in this study) ...
-
WB, IHC, IF,ELISA
Cat# A5522, SKU# A5522-100ul,
100ul, $157.00
Ask
Arkadiy K. Golov, et al.,
bioRxiv - Genomics 2023
Quote:
... brought the volume of RIPA to 1 mL and supplemented it with 1× PIC (Bimake, B14001). Subsequent incubation with antibodies ...