-
No products found
because this supplier's products are not listed.
Bessie Liu, et al.,
bioRxiv - Microbiology 2022
Quote:
... and were embedded using Sub Xero OCT compound (Mercedes Medical), frozen on dry ice ...
-
No products found
because this supplier's products are not listed.
Michelle M. Dominguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... then were carefully sub-cultured to 3×4 Magenta GA-7 vessels (Bio-World, Dublin, OH). The seeds remained under these conditions until epicotyls grew to approximately 7.5 cm in height ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Nejla Ozirmak Lermi, et al.,
bioRxiv - Cancer Biology 2021
Quote:
DNA methylation analysis of the MLH1 gene was performed on DNA from frozen tissue samples of 7 tumors and 3 normal tissue (duodenum and blood) samples using a targeted NGS assay (EpigenDx, Hopkinton, MA). In brief ...
-
No products found
because this supplier's products are not listed.
Jing-Xin Feng, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Dehydrated bones were then embedded in OCT (SAKURA, #4583) blocks using Precision Cryoembedding System (IHC WORLD, #IW-P101).
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
No products found
because this supplier's products are not listed.
Huifang Bai, et al.,
bioRxiv - Zoology 2021
Quote:
... Records were selected systematically from 7 databases (Medline via to Pubmed ...
-
No products found
because this supplier's products are not listed.
Hajar Mikaeili, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 7-10 µm thick) and Human Prostate Frozen Sections (HF-408, 7-10 µm thick) were obtained commercially from Zyagen (www.zyagen.com) via AMS Biotechnology (https://www.amsbio.com ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Mark K. Adams, et al.,
bioRxiv - Systems Biology 2019
Quote:
... One mL of FBS (Peak Serum, Inc, Wellington CO) was added the next morning ...
-
No products found
because this supplier's products are not listed.
Savannah J. Ryburn, et al.,
bioRxiv - Genetics 2023
Quote:
... and Sanger sequenced in one direction by Eton Bioscience in Durham ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Kristen A. Gaffney, et al.,
bioRxiv - Biophysics 2021
Quote:
... iodoacetyl-7-nitrobenz-2-oxa-1,3-diazol (IA-NBD, Setareh Biotech) (42) ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... The surface of a sensor chip CM-5 was conjugated with EDC (0.4 M) and NHS (0.1 M) followed by 10 mM 6-amino-6-deoxy-β-cyclodextrin (CycloLab) suspended in HBS-N buffer (a HEPES balanced salt solution with pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Douglas S. Reed, et al.,
bioRxiv - Microbiology 2023
Quote:
... −6 to −15 psi (AGI; Ace Glass, Vineland, NJ). Particle size was measured once during each exposure at 5 minutes using an Aerodynamic Particle Sizer with a diluter at 1:100 (TSI ...
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Zachary C. Holmes, et al.,
bioRxiv - Microbiology 2021
Quote:
... their urine was subjected to a pregnancy test (Quidel QuickView One-Step hCG Urine Test) to minimize the risk that prebiotic treatment would impact newborn or infant health ...
-
No products found
because this supplier's products are not listed.
Maja Gehre, et al.,
bioRxiv - Genetics 2019
Quote:
... Lysis buffer was prepared by diluting one part direct-lysis reagent (301-C, Viagen Biotech) in two parts destilled water (e.g ...
-
No products found
because this supplier's products are not listed.
Sydney Risen, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... One section per animal was deparaffinized and stained with hematoxylin (Cancer Diagnostics, Cat#: #HTV-4) and eosin (Cancer Diagnostics ...
-
No products found
because this supplier's products are not listed.
Richard J. Marsh, et al.,
bioRxiv - Cell Biology 2021
Quote:
COS-7 cells (CRL-1651, ATCC) cultured on 25-mm-diameter coverslips (CSHP-No1.5-25, Bioscience Tools) were first fixed with 37 °C pre-warmed 3% PFA (15710 ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Ramona Haji-Seyed-Javadi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
ChIP assay was performed using ChromaFlashTM One-Step ChIP Kit (P-2025, Epigentek, Farmingdale, NY, USA) according to the manufacture’s instruction ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Caleb K. Stubbs, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... after which medium was replaced with fresh medium containing with 7 nM Protective antigen (PA) alone (List Labs, #171E) or in the presence of 3 nM LFNRRSP/ LFNRRSPH4030A and incubated at indicated timepoints at 37°C in the presence of 5% CO2.
-
No products found
because this supplier's products are not listed.
Cameron J Glasscock, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... 50 μL of overnight cells were added to 1.95 mL of complete R-media (Supplementary Tables 5-7) and appropriate antibiotics in glass hungate tubes (ChemGlass). 0.1 mM IPTG was added for induction of the upstream pathway enzymes and p5Trc/p10Trc expression ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Phillip Nußbaum, et al.,
bioRxiv - Microbiology 2020
Quote:
... One ml of the nutrition pad solution was poured in a round Delta T Dish (Bioptechs Inc.). After the pad had solidified 3 µl of cells in very early exponential phase (OD600 0.05-0.1 ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Marina Barba-Aliaga, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and mixed with one volume of glass beads for further homogenization in a Precellys tissue homogenizer (Bertin Corp.). Lysates were cleared by centrifugation at 12000 rpm for 5 min at 4°C and protein extracts were assayed for firefly and Renilla luciferase activity sequentially in a 96-well luminometry plate (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Dakota R. Robarts, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... and GenX (Synquest Laboratories cat # 2122-3-09, lot # 00008887) were dissolved in 0.5% Tween-20 at final concentrations of 0.067 g/L ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Mary Kefi, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... After validation of recombinant protein expression of expected size in Sf9 cells and determination of viral stock titers using baculoQUANT ALL-IN-ONE (GenWay), according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kavya Prasad, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... mounted in Vectashield Antifade solution (4’,6 diamidino-2-phenylindole, Vector laboratories H-1200, Axxora/Alexis, Lörrach, Germany) with DAPI and cover with 24×60 mm coverslip sealed with a nail polish ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
José R Pittaluga, et al.,
bioRxiv - Immunology 2024
Quote:
... A PVP-free polycarbonate membrane (3 µm pore size; Neuro Probe Inc. Gaithersburg MD, USA) separated cells from lower wells containing either RPMI or the stimulus (pRNA or CM) ...
-
No products found
because this supplier's products are not listed.
Katherine P. Mueller, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and Mycoplasma testing within 6 months of use with the e-Myco mycoplasma PCR detection kit (iNtRON Biotechnology Inc, Boca Raton, FL). Cell lines were maintained in culture at 37°C in 5% CO2.
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
Anti-RNP was detected in female 52 week old C57Bl/6 and 32-52 week old NZM2328 mice (harvested at time of nephritis or at 52 weeks) via ELISA (Alpha Diagnostics, San Antonio, TX) according to manufacturer’s instructions.