-
No products found
because this supplier's products are not listed.
Héctor M Ramos-Zaldívar, et al.,
bioRxiv - Neuroscience 2024
Quote:
... or a carboxylic acid group (HS-PEG-COOH MW 5K, JenKem Technology, TX, USA) at the other ...
-
No products found
because this supplier's products are not listed.
Kaamini M. Dhanabalan, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 50:50 and 65:35) of different molecular weights from 10,000 - 85,000 Da having carboxylic acid end groups were purchased from Akina (AP041) (West Lafayette ...
-
No products found
because this supplier's products are not listed.
Gurcharan Kaur, et al.,
bioRxiv - Genetics 2023
Quote:
... stained with Alcian blue (1% in 3% Acetic Acid, Poly Scientific) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Matteo Lunghi, et al.,
bioRxiv - Microbiology 2021
Quote:
... and trimethylsilylated shortly before analysis through addition of 20 μl N,O-bis(trimethylsilyl)trifluoroacetamide with 1 % trimethylchlorosilane (BSTFA-TMCS, Cerilliant, Sigma B-023). The GC-MS instrumentation and settings (electron ionization mode ...
-
No products found
because this supplier's products are not listed.
Sudhir Kumar, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocyte cultures were set up in 6 well plates using O+ human RBCs (Valley Biomedical, VA, US) and O+ human serum (Interstate Blood Bank ...
-
No products found
because this supplier's products are not listed.
Emmeline L. Blanchard, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The RNA was heat denatured at 65°C for 10 minutes before capping with a Cap-1 structure using guanylyl transferase and 2’-O-methyltransferase (Aldevron). mRNA was then purified by lithium chloride precipitation ...
-
No products found
because this supplier's products are not listed.
Teri N. Hreha, et al.,
bioRxiv - Immunology 2023
Quote:
... O and K serotypes (1:200, Meridian Life Science #B65109G), Rat anti-Ly6G-APC (1:200 ...
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Rio Kashimoto, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... globulus alkaline lignin was degraded by microwave solvolysis using a mixture (15 mL) of deuterated acetic acid and D2O (2:1) containing 1 mM TsCl in a microwave reactor (Biotage Initiator Plus) at 160° C for 30 min (Entry 22) ...
-
No products found
because this supplier's products are not listed.
Shariq S. Ansari, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-AC5/6 (FabGennix, 1:75), anti-AC3 (Proteintech ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-mature SP-B (rabbit polyclonal, 1:1000, Seven Hills Bioreagents), both generous gifts from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
Pedro Aguilar-Garrido, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the cells were selected by blasticidin (2 μg/mL) (AG Scientific, CA, USA, Cat# B-1247) and hygromycin (400 μg/mL ...
-
No products found
because this supplier's products are not listed.
Mesfin Meshesha, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and SARS-CoV-2 lineage B.1.1.529 (Omicron Variant) culture fluid (UV inactivated, 0810642UV, Zeptometrix LLC, USA) and (heat inactivated ...
-
No products found
because this supplier's products are not listed.
Anna Stier, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or Aurora B (SignalChem) kinases ...
-
No products found
because this supplier's products are not listed.
Ian J. Campbell, et al.,
bioRxiv - Biochemistry 2020
Quote:
... MA) and commercially available screens including Wizard Classic 1 and 2 and Wizard Classic 3 and 4 (Rigaku Reagents, Inc., Bainbridge Island, WA), MORPHEUS and MIDAS (Molecular Dimensions ...
-
No products found
because this supplier's products are not listed.
Tom Benson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... C57BL/6 2-month-old mouse blood preserved with ACD 20% on ice was purchased from BioIVT Inc. ...
-
No products found
because this supplier's products are not listed.
Sang Dang Huynh, et al.,
bioRxiv - Plant Biology 2023
Quote:
... supplemented with hygromycin B (PhytoTechnology Laboratories) at a final concentration of 50 µg/ml ...
-
No products found
because this supplier's products are not listed.
Georgia Chatzinikolaou, et al.,
bioRxiv - Genetics 2020
Quote:
... IF:1:50), TAF-6 (TAF2G7, wb: 1:500) and TAF-10 (6TA-2B11, wb: 1:500) were from ProteoGenix. Streptavidin-HRP (wb ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Camilla Schinner, et al.,
bioRxiv - Cell Biology 2021
Quote:
... with 2x gentamicin/amphotericin B (CELLnTEC, Bern, Switzerland) over night at 4 °C ...
-
No products found
because this supplier's products are not listed.
D. Hoffman, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 50 μg/ml hygromycin B (Omega Scientific). Lytic reactivation was induced by treatment with 20 ng/ml 2-O-tetradecanoylphorbol-13-acetate (TPA ...
-
No products found
because this supplier's products are not listed.
Emily A Wheeler, et al.,
bioRxiv - Immunology 2023
Quote:
... and Factor B were purchased from Complement Technologies.
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
Cat# F107,
USD $169.00/EA
Ask
Ran Lin, et al.,
bioRxiv - Molecular Biology 2024
Quote:
The eluted HIS-tagged MED1 IDR proteins and their controls (2-3 mL for each) were transferred into 15.5 mm size cellulose dialysis tube (BioDesign) and dialyzed with 1 L of dialysis buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Shannon E. Paquette, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The digest reaction product was run in a 2% agarose gel containing RedSafe nucleic acid staining solution (Bulldog Bio Inc, Cat. No. 21141). The gel results were visualized using the Bio-Rad Gel Doc XR+.
-
No products found
because this supplier's products are not listed.
Sara M. Eslami, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Quartz spectrophotometer cell (Starna Cells, cat. no. 1-Q-2) and measured using an Olis Cary-16 circular dichroism spectrometer ...
-
No products found
because this supplier's products are not listed.
David P. Cook, Barbara C. Vanderhyden,
bioRxiv - Cell Biology 2020
Quote:
... PCR products were then run on a 1% agarose gel containing RedSafe Nucleic Acid Staining Solution (Intron Biotechnology) and visualized with an EpiChem II Darkroom Transilluminator (UVP Laboratory).
-
No products found
because this supplier's products are not listed.
Johannes S. P. Doehl, et al.,
bioRxiv - Microbiology 2021
Quote:
Volocity (V.6; Quorum Technologies, Laughton, UK), was used for amastigote to epidermis distance measurements ...
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...
-
No products found
because this supplier's products are not listed.
Megan E. Patton, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Calorimetric measurement of serum and hepatic bile acids was performed with the Total Bile Acid (NBT method) kit (Genway Biotech).
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Ji Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Sample was combined with Biomix B and BirA (as per Avidity protocol) and incubated at 4°C for 14 hours ...
-
No products found
because this supplier's products are not listed.
Reuben McGregor, et al.,
bioRxiv - Immunology 2020
Quote:
... All reactions were carried out in triplicate using 18s and UBC (geNorm 6 gene kit, catalogue number ge-SY-6 from PrimerDesign UK) as housekeeping genes ...
-
No products found
because this supplier's products are not listed.
Yan Liu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... adult mice were immunized by intradermal injection of 100 µg of bovine type II collagen that was emulsified in 100 µl of emulsion containing 50 µl acetic acid (0.01 M) and 50 µl CFA (1 mg/ml Myobacterium tuberculosis; Chondrex Inc, Woodinville, WA) at the base of the tail ...
-
No products found
because this supplier's products are not listed.
Akila Wijerathna-Yapa, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The samples were acidified to 1% (v/v) with formic acid and solid-phase extraction cleaned using Silica C18 Macrospin columns (The Nest Group). After each of the following steps ...
-
No products found
because this supplier's products are not listed.
Caroline Murawski, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 2 µm S1818 (Microchem, 5000 rpm, baking at 100°C for 1 min). Patterns were developed for 40 – 50 s in MF319 (Microchem) ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Andrea Scelfo, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... cells were blocked for 1h in 2% BSA in 0.1% Tween-20 in PBS and then incubated anti-5MC antibody (1:500; A-1014 Epigentek) in 0.1% Tween-20 in PBS overnight at 4°C and subsequently after washing with 1:500 anti-mouse Cy5-conjugated in 0.1% Tween-20 in PBS for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Jae Yeong Ha, et al.,
bioRxiv - Pathology 2023
Quote:
... Tissue samples were analyzed using the ELISA kits for IL-6 (KET7009; Abbkine, Wuhan, China) and TNF-α (ADI-900- 047 ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... The protein was expressed in 2 L of Sf9 cells at 2×106 cells/mL maintained in ESF921 media (Expression Systems) by adding 25 mL virus per liter of culture ...
-
No products found
Branden A. Smeester, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Blots were thoroughly washed following 2° incubation and developed using the WesternBright Quantum detection kit (Advansta) and the LICOR Odyssey (LICOR) ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).