-
No products found
because this supplier's products are not listed.
Julia L. Daiß, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Top2a was obtained from Inspiralis (c/n HT210). Proteins were incubated together in pulldown buffer (25 mM TrisHCl pH7.9 ...
-
No products found
because this supplier's products are not listed.
Heesun Kim, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... transferred to Poly-L-lysine coated slides (Labscientific, 7799) and mounted with 10 μl of SlowFade Diamond Antifade Mountant with DAPI (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Sora Kim, et al.,
bioRxiv - Biophysics 2022
Quote:
... The LLYVQRDSKEC-fluorescein N-degron synthetic peptide (21st Century Biochemicals [Marlborough ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Simona Iftimie, et al.,
bioRxiv - Microbiology 2020
Quote:
... Tests were carried out with the VIASURE SARS-CoV-2 Real Time PCR Detection Kit that detects ORF1ab and N genes (CerTest Biotec, Zaragoza, Spain). RNA was extracted in a QIAcube apparatus with RNeasy reagents (Qiagen N.V. ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Maria Calvo-Rodriguez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and incubated with target antibodies at 4C o/n (GFP (1:500, Antibodies Incorporated Cat# GFP-1020, RRID:AB_10000240), HSP60 (1:200 ...
-
No products found
because this supplier's products are not listed.
Céline Petitgas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The primary antibodies used were mouse monoclonal anti-TH (1:1000, cat. n° 22941, ImmunoStar, Hudson, WI, USA) and mouse monoclonal anti-DA (1:100 ...
-
No products found
because this supplier's products are not listed.
Michael S. Haney, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The dissociated neurons were then plated onto 24-well plates with coverslips coated with poly-l-lysine (Newcomer Supply, 1339A) using minimum essential medium (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
Zhimin Liu, et al.,
bioRxiv - Systems Biology 2020
Quote:
... ∼7.4 × 109 of frozen cells were inoculated into 1.2 L media in a 2 L Delong flask (Bellco). The cells were grown for a total of 21 generations ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Tawna L. Mangosh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Hybridization with 333ng/mL of a TelC-Cy5-labeled peptide nucleic acid (PNA) oligonucleotide telomere probe (N-CCTAACCTAACCTAA-C, PNA BIO) in PNA buffer (10mM Tris pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Cody A. Cushing, et al.,
bioRxiv - Neuroscience 2023
Quote:
... measured by the Behavioral Activation Scale (BAS) and Eysenck Personality Questionnaire-Neuroticism (EPQ-R-N) (Carver & White, 1994; Eysenck & Eysenck, 1993). Participants were ineligible if meeting any of the following criteria ...
-
No products found
because this supplier's products are not listed.
Rui Zhang, et al.,
bioRxiv - Immunology 2019
Quote:
Western blot analysis was performed as previously described (19) Antibodies used were as follows: polyclonal rabbit anti DRAM1 (N-terminal) (1:1000,ARP47432-P050, Aviva systems biology), polyclonal rabbit anti-Optineurin (C-terminal ...
-
No products found
because this supplier's products are not listed.
Maya A. Farha, et al.,
bioRxiv - Microbiology 2020
Quote:
Overnight cultures of the collection22 (at a 96-well density, n = 289) were performed using the Singer rotor HDA (Singer Instruments, United Kingdom) in CAMHB ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Valeria Garcia-Flores, et al.,
bioRxiv - Immunology 2022
Quote:
... the slides were incubated with DAPI (4′,6-diamidino-2-phenylindole) as a nuclear counterstain and mounted using AquaSlip™ Aqueous Permanent Mounting Medium (American MasterTech). Fluorescence image acquisition was performed using the Vectra Polaris Multispectral Imaging System at 20x magnification ...
-
No products found
because this supplier's products are not listed.
Siran Zhu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 150 pmol of 6×His-streptavidin (ProteoGenix) was mixed with 5 μl of sieved beads (10% ...
-
No products found
because this supplier's products are not listed.
Daniel P Myatt, et al.,
bioRxiv - Biophysics 2022
Quote:
... (6) using plasmid DNA purchased from Aldevron, UK with the reaction optimised as per the design-of-experiment (DOE ...
-
No products found
Alexander J. Ehrenberg, et al.,
bioRxiv - Pathology 2019
Quote:
... goat-anti-guinea pig IgG (H+L) – (R-05076, Advansta, or goat-anti-Rabbit IgG (H+L)-R-05072 ...
-
No products found
because this supplier's products are not listed.
Janin Lautenschläger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 mM in DMSO and MitobloCK-6 (Focus Biomolecules) 5 mM in DMSO.
-
No products found
because this supplier's products are not listed.
Kameron Y. Sugino, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... according to the manufacturer’s protocol with 1:100 serum dilution and were analyzed for IL-6 using an old world monkey IL-6 ELISA kit (U-CyTech Biosciences, the Netherlands) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Eric P. Schultz, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 6% Fetalgro® (Rocky Mountain Biologicals, Missoula, MT, USA). Retinal pigment epithelial cells (ARPE19)(American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Chih Hung Lo, et al.,
bioRxiv - Bioengineering 2023
Quote:
... INS-1 β-cells treated with respective conditions were stained with 10 μg/mL Magic red cathepsin L (MR-cathepsin L, Immunochemistry Technologies, Cat# 941) for 1 h ...
-
No products found
because this supplier's products are not listed.
Kristina Thamm, et al.,
bioRxiv - Cell Biology 2021
Quote:
... On day 6 the cells were detached using CnT-Accutase-100 (CELLnTEC) and counted.
-
No products found
because this supplier's products are not listed.
Pinja Kettunen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM Xav939 (BioGems).
-
No products found
because this supplier's products are not listed.
Kathy N. Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... Small volume l iquid handlers such as the Mosquito HTS (TTP LabTech) and Mantis (Formulatrix ...
-
No products found
because this supplier's products are not listed.
Naomi E. Widstrom, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2 mM ATP) and 2 ug of recombinant kinase (SignalChem; Tyro3 (aa 455-end): T22-11G ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and R3(B1-22)R (0.1 μmol/L, Phoenix Pharmaceuticals Inc, CA,USA) (19 ...
-
No products found
because this supplier's products are not listed.
Saurav Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... pMD2.G and psPAX2 in 2:1:2 ratio with PolyJet transfection reagent (SignaGen Laboratories). Media were harvested two days later and added to recipient cells with 1 μg/ml polybrene (Sigma ...
-
No products found
because this supplier's products are not listed.
Charles D Cox, et al.,
bioRxiv - Biophysics 2021
Quote:
... and the cells broken with a TS5/48/AE/6□A cell disrupter (Constant Systems) at 31,000□psi at 4°C ...
-
No products found
because this supplier's products are not listed.
Ruhul Amin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 6-well plates with elastic moduli of 0.2 kPa (considered soft) was purchased from Matrigen. Regular 6-well tissue culture dishes were used to represent stiff matrices (elastic moduli is >GPa) ...
-
No products found
because this supplier's products are not listed.
Yuta Koganezawa, et al.,
bioRxiv - Genetics 2021
Quote:
... we spin-coated SU8-2 (MicroChem) on the wafer with the target height of 1.2 µm ...
-
No products found
because this supplier's products are not listed.
Abhichart Krissanaprasit, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 2 mg/mL fibrinogen (Enzyme Research Laboratories), 0.1 mg/mL Alexa-Fluor 488 labeled fibrinogen for visualization (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... A SARS-CoV-2 neutralization antibody (EpiGentek), which targets the spike RBD ...
-
No products found
because this supplier's products are not listed.
Yifei Cai, et al.,
bioRxiv - Neuroscience 2022
Quote:
... human iPSCs maintained in 6-well-plates were harvested by incubating in Accutase (Innovative Cell Technologies AT104) 1 mL/per well plus 10 µM ROCK inhibitor THX (RI)(Tocris #1254 ...
-
No products found
because this supplier's products are not listed.
Dheva Setiaputra, et al.,
bioRxiv - Molecular Biology 2021
Quote:
µL PPB1 and 50 µL of 10 mg/mL HeLa nuclear extracts (Accurate Chemical, Carle Place NY) and incubated by rotating at 4°C ...
-
No products found
because this supplier's products are not listed.
Lamiaa El-Shennawy, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with EM goat anti-mouse IgG (H&L) 10 nm gold conjugated (BBI solutions, EM.GMHL10) (7:100 ...
-
No products found
because this supplier's products are not listed.
Hannah L. Bernstein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Slices were in the chamber for 30 min with sucrose-based ACSF at 1-2 mL/min (#Minpuls 2, Gilson) and then NaCl-based ACSF (125 mM NaCl instead of sucrose ...
-
No products found
because this supplier's products are not listed.
Melika Shahhosseini, et al.,
bioRxiv - Bioengineering 2022
Quote:
... supplemented with 2% heat-inactivated FBS (Atlas Biologicals), and 1mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Lihong Chen, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... 2 mg monoclonal antibody to collagen II (Chondrex) in 50 ul of PBS was administered by intraperitoneal injection ...
-
No products found
because this supplier's products are not listed.
Biliana Marcheva, et al.,
bioRxiv - Cell Biology 2021
Quote:
... RNA was extracted from Beta-TC-6 cells and pseudoislets using Tri Reagent (Molecular Research Center, Inc, Cincinnati, OH) and frozen at ™80°C ...
-
WB, IHC, IF,ELISA
Cat# A5442, SKU# A5442-100ul,
100ul, $157.00
Ask
Joana F. da Rocha, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2 μL of 1:10 diluted cDNA was added to 10 μL of 2× SYBR® Green Supermix (Bimake, Houston, Texas, USA) and the final concentration of each primer was 250 nM in 20 μL of total volume ...
-
No products found
because this supplier's products are not listed.
Alison C. Leonard, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 2000V using a 2 mm electroporation cuvette (Bulldog Bio) and Eppendorf electroporator and then plated on yeast extract peptone dextrose plus sorbitol plates (YPDS ...
-
No products found
because this supplier's products are not listed.
Cato Prince, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 2 mM MgCl2 and 200 U of mSAN nuclease (Arcticzymes catalog #70950-150). Cell lysates were incubated at 37°C for 1 hour ...
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...