-
No products found
because this supplier's products are not listed.
Camila Marques-da-Silva, et al.,
bioRxiv - Immunology 2023
Quote:
... 6-8×105 primary mouse or human (obtained from BioIVT) hepatocyte cultures were infected with 2-4×104 sporozoites in each well of a 6-well plate ...
-
Cat# R5007-5mg,
USD $133.86/ea
Ask
Daniela Rubio-Olaya, et al.,
bioRxiv - Biophysics 2022
Quote:
... pH 8) in the presence of HydraGreen (3 mL, ACTGene, USA) as the intercalating agent ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Antonio Frasca, et al.,
bioRxiv - Bioengineering 2020
Quote:
8-10 mm discs of BP were rinsed 3 times in 0.9% saline (Rocky Mountain Biologicals, Missoula, MT, USA) and then incubated for 24 hours at 37°C in 0.9% saline ...
-
No products found
because this supplier's products are not listed.
Lily R. Zehfus, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Quercetin-3-O-glucoside and isorhamnetin-3-O-glucoside were obtained from Indofine Chemical Company ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Sunny Sharma, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 25 μg of cleaved RNA was separated by electrophoresis on 8% urea polyacrylamide gels supplemented with 0.3% 3-acrylamidophenylboronic acid (Boron Molecular). RNA was transferred to positively charged Nylon transfer membrane (GE Healthcare Life Sciences) ...
-
No products found
because this supplier's products are not listed.
Sang-Chul Kim, et al.,
bioRxiv - Biochemistry 2022
Quote:
... polyclonal anti-CCA1 (R1234-3, Abiocode), and polyclonal anti-histone H3 (A01502 ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... allowed to sit for 3 hours and treated with recombinant mouse IL-4 (Leinco technologies, Inc. I-207) for 4 hr ...
-
No products found
because this supplier's products are not listed.
María del Pilar Martínez-Diz, et al.,
bioRxiv - Microbiology 2020
Quote:
... DNA was extracted from 0.5 g of xylem tissue collected between 3- to 8-mm from the pruning wound using the i-genomic Plant DNA Extraction Mini Kit (Intron Biotechnology, South Korea). DNA yields from each sample were quantified using the Invitrogen Qubit 4 Fluorometer with Qubit dsDNA HS Assay (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Bruno Motta Nascimento, Nikhil Unni Nair,
bioRxiv - Bioengineering 2020
Quote:
... coli were hydrolyzed 6 M HCl at 100 °C for 4 h in a vacuum sealed tube (Chemglass, #CG-4025-01). Acid was immediately removed with a vacuum centrifuge and pellet was resuspended in deionized water ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Stephen Meek, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 ng/ml rpIL-3 (Kingfisher Biotech, #RP1298S). Attached EBs were fed every 4 days with Macrophage Induction medium ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Ian Hoskins, et al.,
bioRxiv - Genomics 2023
Quote:
gDNA was extracted from approximately 3-4 million cells with the Cell and Tissue DNA Isolation Kit (Norgen Biotek Corp, 24700), including RNaseA treatment at 37 °C for 15 min ...
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Jose Aguiar-Cervera, et al.,
bioRxiv - Microbiology 2024
Quote:
... The yeast strains were revived from –80 °C in YPD broth and arranged in 3×4 squares (Fig. S1A) on SBS PlusPlates containing solidified 12 °Bx wort and YPD using the PIXL (Singer Instruments, UK) robotic platform ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Clara Alameda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... participants were fitted with 3-ECG electrodes (Ambu, Ballerup, Denmark) and a 64-channel actiCHamp EEG system (Brain Products ...
-
No products found
because this supplier's products are not listed.
N.J.M van den Brink, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 60 % 3 D barrier medium (CELLnTEC, CnT–PR–3D)) and 24 hours afterwards the HEEs were lifted to the highest stand ...
-
No products found
because this supplier's products are not listed.
Shahrnaz Kemal, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All vectors contain an N-terminal 6x-His-tag, C terminal Strep-Tag II tag, with or without a N or C terminal fluorophore (EGFP, mNeonGreen (Allele Biotech), or mRuby2).
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Linda D. Hicks, et al.,
bioRxiv - Microbiology 2021
Quote:
... or 3) human factor H-depleted serum (FHDS; Complement Technology; Tyler, TX) diluted in HIB to give a 50% concentration ...
-
No products found
because this supplier's products are not listed.
Amirala Bakhshian Nik, et al.,
bioRxiv - Pathology 2022
Quote:
... Osteoblasts (passage 4-6) were harvested using 0.25% trypsin-EDTA solution (Caisson Labs, TRL01), seeded with a density of 5,200 cell.cm-2 ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Tural Aksel, et al.,
bioRxiv - Bioengineering 2022
Quote:
Recombinant ubiquitin with N-terminal Histag (BPS Biosciences, P/N: 79293) and Alexa647-proteinA conjugate (Thermofisher ...
-
No products found
because this supplier's products are not listed.
Mathieu Métivier, et al.,
bioRxiv - Cell Biology 2020
Quote:
... dialyzed overnight in PBS at 4°C and used for guinea pig immunization (Covalab).
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Judit Vágó, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Equal amounts of protein (3 µg) were loaded into 12–230 kDa separation modules (Protein Simple, Bio-Techne ...
-
4-Chloro-3-nitropyridine is a chemical reagent.
Cat# abx183566-5G,
5 g USD $130.5
Ask
Mark Møiniche, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by incubation with a primary rabbit anti-Mal d 3 polyclonal antibody (Catalog #abx300086, Abbexa) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Arthritis severity was monitored daily after day 3 using the criteria for clinical scores established by Chondrex, Inc. ...
-
No products found
because this supplier's products are not listed.
Ruikang Liu, et al.,
bioRxiv - Microbiology 2021
Quote:
... the wells were washed 3 times with 250 μl of PBS + 0.05% Tween 20 (PBS-T, Accurate Chemical) and plates were blocked with 200 μl PBS-T + 5% Nonfat Dry Milk for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Jianying Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the cells were incubated at 4°C with goat anti-nucleostemin overnight (1:350, Neuromics, Edina, MN). Then the cells were washed with PBS 3 times and incubated with cyanine 3 (Cy3)-conjugated donkey anti-goat IgG secondary antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
Native Antigen
Cat# NAT41570-100,
100ug USD $426.0
Ask
Roberta Marzi, et al.,
bioRxiv - Immunology 2022
Quote:
... N (The Native Antigen Company, REC31812), SARS-CoV S (produced in house) ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Antonella Bordin, et al.,
bioRxiv - Cell Biology 2022
Quote:
... ALIX (1:1000, Biorbyt, Cat. N. orb235075), CD9 (1:500 ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...