-
No products found
because this supplier's products are not listed.
Michelle M. Dominguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... then were carefully sub-cultured to 3×4 Magenta GA-7 vessels (Bio-World, Dublin, OH). The seeds remained under these conditions until epicotyls grew to approximately 7.5 cm in height ...
-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Stephen C. Gironda, et al.,
bioRxiv - Neuroscience 2022
Quote:
ISF glucose and ethanol concentrations were measured in each ISF sample from 3-month-old APP/PS1 mice (n=4) using the YSI 2900 analyzer (YSI incorporated) per the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Dennis J Doorduijn, et al.,
bioRxiv - Immunology 2019
Quote:
... Nunc Maxisorp ELISA plates were coated overnight at 4 °C with 50 µl/well of 3 µg/ml monoclonal mouse IgG1 anti human C6 (Quidel) in PBS ...
-
No products found
because this supplier's products are not listed.
Margaret M. McDaniel, Vitaly V. Ganusov,
bioRxiv - Immunology 2019
Quote:
... We fitted either recirculation model (panels A&C, see eqns. (3)–(9) ...
-
No products found
because this supplier's products are not listed.
Selena Y. Lin, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PG donors 3 and 4 had only plasma obtained by Lee Biosolution. In this case ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and 4-chloro-DL-phenylalanine methyl ester hydrochloride (PCPA) were purchased from Neta Scientific. Pertussis toxin (PTx ...
-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Ha Won Lee, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... combinations of DMSO or 11 does of sotrastaurin and DMSO or 7 doses of ingenol-3-angelate were dispensed in quadruplicate using an Echo555 (Labcyte). Immunostaining and quantification of the B7-H3 protein expression level were performed as described above in the high-content imaging screening assay method section ...
-
Superoxide dismutase (SOD) is an antioxidant enzyme involved in the defense system against...
Cat# PBCA1002,
Inquiry
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
K. R. Breit, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... An 8-point standard curve containing nicotine (Cerilliant N-008-1ML), and cotinine (Cerilliant C-016-1ML ...
-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... Specific proteins were detected using rabbit anti-VP8* P[8]/P[4] or P[6] polyclonal antibodies (1:1,000; generated in this study by Aldevron Freiburg GmbH), guinea pig anti-LS-P2-VP8* P[8] polyclonal antiserum (1:500 ...
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
No products found
because this supplier's products are not listed.
Carole Fruchart Gaillard, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... cells were incubated for 2h at 37°C with 5 μg/ml DiI-LDL (1,1’-dioctadecyl-3,3,3’,3’-tetramethyl-indocarbocyanine perchlorate, Cedarlane/Kalen Biomedical) in SFM media before fixation ...
-
No products found
because this supplier's products are not listed.
Kira Cozzolino, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Nuclear run-ons were performed for 3 minutes at 37°C on a Groovin’ Tubes thermoshaker (Boekel Scientific, 270500), on a mixture of 10 million human and 100,000 Drosophila melanogaster nuclei per replicate ...
-
No products found
because this supplier's products are not listed.
Cornelia Blume, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Data were normalised to the geometric mean of the housekeeping genes (ubiquitin C and glyceraldehyde 3-phosphate dehydrogenase, probe-based duplex primer mix, PrimerDesign) and fold change in gene expression relative to controls was determined using the ΔΔCt method ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Membranes were blocked in skim milk and incubated with anti-MASP-3 mAb 38:12-3 (Hycult Biotech, HM2216) for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent ...
-
No products found
because this supplier's products are not listed.
Niek Andresen, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... The cages contained fine wooden bedding material (LIGNOCEL® 3–4 S, J. Rettenmaier & Söhne GmbH + Co. KG, Rosenberg, Germany) and nest material (nestlets: Ancare, UK agents ...
-
No products found
because this supplier's products are not listed.
Koushik Debnath, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by negative staining with 8 μL of 6% uranyl acetate (SPI Supplies) in Milli-Q water for 20 s at RT in dark ...
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
James T. McKenna, et al.,
bioRxiv - Neuroscience 2020
Quote:
Mice were deeply anesthetized with isoflurane (1-3%) and viral injections were performed using a 1 µl Hamilton syringe (Cat#7001KH, Point Style 3, Hamilton Company, Reno, NV, USA), targeting BF (AP +0.14 mm ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Hillary A. Wadsworth, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 5-(3-Bromophenyl)-1,3-dihydro-2H-benzofuro[3,2-e]-1,4-diazepin-2-one (5-BDBD) (cat. no. T22518, TargetMol, Wellesley Hills, Massachusetts, USA) were dissolved in stock solutions and then diluted into ACSF at specified concentrations (50 µM IVM ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Chun Hu, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Protein expression was induced by baculovirus infection of 6-8 liter cultures of Sf9 cells in ESF921 medium (Expression Systems) at a density of ~2 × 106 cells/ml ...
-
No products found
because this supplier's products are not listed.
Kristi Dietert, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A total of 21,600 cells were plated onto the upper wells (n=6/condition) of 96-well poly-l-ornithine (PLO) coated chemotaxis chambers (10 μm pore size, Neuro Probe Inc) and maintained in DMEM containing l-glutamine (1 mM) ...
-
No products found
because this supplier's products are not listed.
Rebekka Medert, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Pools of 2 or 3 E4.5 blastocysts were lysed in 10 μl lysis buffer (DirectPCR buffer, Viagen, supplemented with 2.5 μg/ml Proteinase K ...
-
No products found
because this supplier's products are not listed.
Rene Yu-Hong Cheng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 3 mL syringes (Becton Dickinson) were connected to the bead and sample inlet reservoirs via PEEK tubing (IDEX) and a coupler molded out of PDMS ...
-
No products found
because this supplier's products are not listed.
Sierra L. Boyd, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4°C artificial cerebrospinal fluid (aCSF) at 300 µm thick using a vibratome (Campden Instruments 5100mz-Plus)57 ...
-
No products found
because this supplier's products are not listed.
Athanasios Stavropoulos, et al.,
bioRxiv - Physiology 2021
Quote:
... tissues were incubated over-night at 4°C with the following primary antibodies: rat anti-RFP (Antibodies-Online, ABIN334653), chicken anti-GFP (Abcam ...
-
No products found
because this supplier's products are not listed.
Sonali Singh, et al.,
bioRxiv - Microbiology 2020
Quote:
... After washing three times with PBS blocking was carried out by adding 50 µl of 3% (w/v) bovine serum albumin (BSA) (80400-100, Alpha diagnostics) prepared in PBS ...
-
No products found
because this supplier's products are not listed.
Ida Søgaard Larsen, et al.,
bioRxiv - Microbiology 2023
Quote:
... and C-peptide by Mouse C-peptide ELISA kit (Crystal Chem) following the manufacturers’ protocols.
-
No products found
because this supplier's products are not listed.
Florian J. Bock, et al.,
bioRxiv - Cell Biology 2020
Quote:
... S63845 (Chemgood, C-1370), Sytox Green (Thermo ...
-
No products found
because this supplier's products are not listed.
Naphat Chantaravisoot, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... IP eluates were loaded into an 8% cartridge of the GELFREE 8100 system (Expedeon). Proteins were subsequently separated into 6 fractions ...