-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
José Leal, et al.,
bioRxiv - Biophysics 2023
Quote:
... a silver/silver-chloride (Ag/AgCl, BASI, USA) electrode as the reference (RE) ...
-
No products found
because this supplier's products are not listed.
Ana Cristina Colabardini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cell lysis was processed by 6 times beating for 3 minutes with ∼100 μl volume of silica beads using Bullet Blender (Next Advance) with at least 3 minutes of cooling in between each cycle ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Rachel Bezalel-Buch, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 39mer 8 atom 6 bp ICL (39+6 DMEDA ICL) were synthesized and purified as previously reported (33) ...
-
No products found
because this supplier's products are not listed.
Qingtao Sun, et al.,
bioRxiv - Neuroscience 2023
Quote:
Biotinylated human IL-6 solution (Acrobiosystems, IL-6-H8218 ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Gina Partipilo, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 6-Azidohexanoic Acid Ester (Click Chemistry tools, > 95%), Alkyne-PEG4-NHS Ester (Click Chemistry Tools > 95%) ...
-
No products found
because this supplier's products are not listed.
N Bhaskaran, et al.,
bioRxiv - Immunology 2021
Quote:
... and IL-6 ELISA kits were from Boster Bio (Pleasanton ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Toshiyuki Harumoto,
bioRxiv - Microbiology 2023
Quote:
... 6 µl GFP-Trap magnetic agarose (ChromoTek, gtmak-20) pre-equilibrated with dilution buffer was added to the diluted lysates ...
-
No products found
because this supplier's products are not listed.
Martin Minařík, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... or a MicroPublisher 6 color CCD camera (Teledyne Photometrics) controlled by Ocular software (Teledyne Photometrics) ...
-
No products found
because this supplier's products are not listed.
Eric B Knudsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Stocks were maintained on 6-well tissue culture treated plates (CELLTREAT) coated with 1% Geltrex (Gibco ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Richard Lindqvist, et al.,
bioRxiv - Biochemistry 2022
Quote:
N-terminal labeling of KSL-128114 with 5-(and-6)-carboxytetramethylrhodamine (TAMRA, Anaspec Inc.) was performed on resin ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
Magnetofection
diificult to transfect cells
Cat# KC30300,
SilenceMag 200µL + Magnetic Plate MF10000, USD $595.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Xiaohui Ju, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated with drugs (Lycorine chloride (TargetMol, T2774), Tubeimoside I (TargetMol ...
-
No products found
because this supplier's products are not listed.
Aino E. Tervo, et al.,
bioRxiv - Bioengineering 2020
Quote:
... The silver/silver-chloride surface electrodes (Ambu Neuroline 720, Ambu A/S, Denmark) were in a bipolar arrangement with the active electrode placed over the muscle belly of the right first dorsal interosseus (FDI ...
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Unsorted Lin− cells or sorted HSCs were cultured in a retronectin-coated 6 cm2 dish with 3 mL viral supernatants for 6 h in 3 mL IMDM media supplemented with 15% heat inactivated fetal bovine serum (Atlanta Biologicals), 1% bovine serum albumin (Gemini bio-products) ...
-
No products found
because this supplier's products are not listed.
Rafael D. González-Cruz, et al.,
bioRxiv - Bioengineering 2023
Quote:
... which was composed of lyophilized papain powder and Hibernate A without calcium chloride (BrainBits, LLC) and pre-warmed to 30°C ...
-
No products found
because this supplier's products are not listed.
Adrienne R. Guarnieri, et al.,
bioRxiv - Physiology 2021
Quote:
... IL-6 (Bioss BSKM1004) and TNF-α (Bioss BSKM1002 ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-6 (Lot: 449268JEI6, Elabscience, China), and IL-10 (Lot ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Dian Kortleve, et al.,
bioRxiv - Immunology 2024
Quote:
... 6% human serum (Sanquin, Amsterdam, the Netherlands), 200 mM L-glutamine ...
-
No products found
because this supplier's products are not listed.
Shih-Heng Chen, et al.,
bioRxiv - Neuroscience 2019
Quote:
... pAAV2/6 (Cell Biolabs Inc., Cat# VPK-426), pAAV2/8 (Cell Biolabs Inc. ...
-
No products found
because this supplier's products are not listed.
Miles H. Black, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and 50 μM 6-biotin-17-NAD+ (Trevigen). Reactions were incubated at 37 °C for 15 minutes ...
-
No products found
because this supplier's products are not listed.
Maximilian Lenz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and TTX (0.5 μM; Biotrend #18660-81-6) were added to the external solution ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Janin Lautenschläger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 mM in DMSO and MitobloCK-6 (Focus Biomolecules) 5 mM in DMSO.
-
No products found
because this supplier's products are not listed.
Fenghua Qian, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and 10 ng/mL mrIL-6 (Gemini bio-products). Cells were harvested ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shivneet K. Gill, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Dilutions of human serum (Human Serum age 4-6, Innovative Research) were performed in TBSM ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Watcharachai Meemetta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Rebecca A. Lea, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Vitrified blastocysts (day 5 and day 6) were thawed using the vitrification thaw kit (Irvine Scientific; 90137-SO) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Takaoki Kasahara, et al.,
bioRxiv - Genomics 2022
Quote:
... or 6 along with its flanking intron regions containing appropriate restriction enzyme sites was synthesized (Biomatik or Genewiz). Each exon of mouse Asmt gene in pcDNA5-FRT-TO was replaced with the human form using the appropriate restriction enzymes ...
-
No products found
because this supplier's products are not listed.
Alena Rudkouskaya, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The excitation was set to 750 nm, and the emission filter were 820±6 nm (Semrock, FF01-820/12-25) and 810±45 (Chroma Technology, ET810/90). The imaging parameters were set the same for all mice.