-
No products found
because this supplier's products are not listed.
Nargis Parvin Laha, et al.,
bioRxiv - Plant Biology 2020
Quote:
... pH 5.7 and 0.06 nCi mL−1 of [3H]-indole-3-acetic acid (15 to 30 Ci mmol−1; Biotrend; ART 0340). The excised stems were incubated in the solution for different time points ...
-
No products found
because this supplier's products are not listed.
C. Jenul, et al.,
bioRxiv - Microbiology 2023
Quote:
... hexakis (1H,1H,2H-difluoroethoxy)phosphazene ions (Apollo Scientific, m/z 622.1978) located on a wick within the source was used ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... 1h DMEM w/o amino acids (Biomol GmbH) + 10% dialyzed FBS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Timothy J. Ross-Elliott, et al.,
bioRxiv - Plant Biology 2019
Quote:
Methyl-β-cyclodextrin was purchased from Frontier Scientific, tyrphostin A51 and turanose were purchased from Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Kevin J. Forsberg, et al.,
bioRxiv - Microbiology 2021
Quote:
... 40% (+/-)-2-methyl-2,4-pentanediol (MPD, Hampton Research), 10mM MgCl2 as a mother liquor ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Stephanie Bruggink, et al.,
bioRxiv - Physiology 2021
Quote:
... A female luer (Figure 1H thread style to 500 series barb 1/16 inch ID tubing Cole-Parmer Instrument #SK-45508-01 connected to tubing Picture 1B Silastic Laboratory Tubing #508-005 ...
-
No products found
because this supplier's products are not listed.
Yuuki Wittmer, et al.,
bioRxiv - Biophysics 2022
Quote:
... ∼6 mL using Millipore Amicon Ultra-15 3 kDa MWCO centrifugal filter and dialyzed (Spectrum Laboratories 1.7 ml/cm standard SpectraPor 1 RC Tubing ...
-
No products found
because this supplier's products are not listed.
AJ Brandner, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... a set of eight monofilaments at logarithmic intervals from 0.008 to 6 grams (0.008, 0.023, 0.07, 0.16, 0.4, 1, 2, and 6 grams; Stoelting, Wood Dale, IL) were applied to the center of the plantar surface of the left hind paw for up to 4 seconds using the up–down method (Chaplan et al. ...
-
No products found
because this supplier's products are not listed.
Gema M. Olivarria, et al.,
bioRxiv - Microbiology 2021
Quote:
... Mac2/ Galactin-3 (1:500, CL8942AP Cedarlane), CD4 (1:200 Abcam) ...
-
No products found
because this supplier's products are not listed.
Peter Njenga Ng’ang’a, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 6 × 104 cells in 1 mL DMEM medium (Pan Biotech) were grown for 48 h before addition of 5.8 nM of toxin ...
-
No products found
because this supplier's products are not listed.
SAKIRUL I KHAN, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and rabbit polyclonal anti-caspase 3 (1:1000; Bioss) plus mouse monoclonal anti-CB (1:1000 ...
-
No products found
because this supplier's products are not listed.
Iris E. Glykofridis, et al.,
bioRxiv - Genetics 2022
Quote:
... Ab #3 (1:1000 in BSA, HPA028760, Atlas antibodies) and Ab #4 (1:1000 in BSA ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The WPRE 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
No products found
because this supplier's products are not listed.
Xiao-Jun Xiang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Then the sections were incubated in 0.3% Triton X-100 in 0.05M PB for 1h and in Streptavidin-Biotin Complex solution (SABC kit, Boster Biological Technology) for 3h at room temperature in sequence ...
-
No products found
because this supplier's products are not listed.
Marcel Bach-Pages, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Arabidopsis leaves of mature plants (5-6 weeks old) were infiltrated with either flg22 (1 μM; Anaspec) or H2O (mock ...
-
TeloCol®-6 is 50 mL of 6 mg/ml, type I bovine telocollagen solution for 2D coatings or 3D...
Cat# 5225-1KIT,
50 mL, USD $440.0
Ask
Colin D. Paul, et al.,
bioRxiv - Bioengineering 2019
Quote:
Cytosoft 6-well plates (Advanced BioMatrix, San Diego ...
-
No products found
because this supplier's products are not listed.
Candida Wong, et al.,
bioRxiv - Immunology 2020
Quote:
Flow cytometry data was analysed using the FCS Express 6 Flow Cytometry Software version 6 (De Novo Software). CHO cells were primarily gated by forward scatter height (FSC-H ...
-
No products found
because this supplier's products are not listed.
Tamar Frankovits, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
Hridindu Roychowdury, Philip A. Romero,
bioRxiv - Biochemistry 2021
Quote:
... Undeveloped photoresist is washed off with SU-8 developer (1-methoxy-2-propanol acetate, MicroChem).
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Xueao Zheng, et al.,
bioRxiv - Plant Biology 2023
Quote:
... was grinded in liquid nitrogen and were extracted by using 3 mL Methyl-tert-butyl ether/methanol/water (10:3:2.5, V/V) containing 10 ng D4-SA (CDN Isotopes, Pointe-Claire, Canada) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Jacob Kumro, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Methyl methacrylate powder (A-M Systems, Everett, WA) was mixed with its respective dental cement solvent until saturated and then a thin layer of the mix was applied to the top of the skull with the periosteal elevators ...
-
No products found
because this supplier's products are not listed.
P. Lejeune, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Jiffypots® with weak or abnormal plantlets were discarded and the others were transplanted into 12-cm square plastic cultivation pots filled with 1.5 L of leaf mould and baked clay (4:1) mixed with 6 gr.L−1 of slow release fertilizer (Osmocote Exact Standard 5-6 M, ICL Specialty Fertilizers). The pots were fitted at the bottom with a 2 x 10 cm felt wick and randomly placed on the deck of the cultivation gutters described above ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Steven R. Talbot, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the cecum was 2/3 ligated (Nylon Monofilament Suture 6/0, Fine Science Tools GmbH, Heidelberg, Germany) distal to the ileocecal valve ...
-
No products found
because this supplier's products are not listed.
Yapeng Li, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The amounts of IL-6 (LS-F31434-1, LifeSpan BioSciences) and TNFα (LS-F57505-1 ...
-
No products found
because this supplier's products are not listed.
E. Bayart, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Immunostaining was performed by incubating membrane 1h at room temperature with 1/1000 diluted of rabbit polyclonal anti-Poly-ADP Ribose (TREVIGEN 4336-BPC-100), rabbit monoclonal anti-PARP1 (Cell Signaling Technology CST#9532 ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Kristen Mehalko, et al.,
bioRxiv - Genetics 2022
Quote:
... The tissue was homogenized using a BeadBug 6 microtube homogenizer for 3 rounds of 30 seconds at 3000 rpm (Benchmark Scientific, 422V16). RNA was purified from homogenized tissue using the Direct-Zol RNA Miniprep kit (Zymo Research ...
-
No products found
because this supplier's products are not listed.
Teng-Chieh Yang,
bioRxiv - Bioengineering 2023
Quote:
... One (1) μm yellow PSP and 6 μm red PSP were from Polyscience Inc ...
-
No products found
because this supplier's products are not listed.
Anja Kopp, et al.,
bioRxiv - Biochemistry 2023
Quote:
Screening of crystallization conditions for wild type GSDMD and GSDMDΔ184-194/Δ247-272 in complex with nanobodies VHHGSDMD-1 to VHHGSDMD-6 and the combination of VHHGSDMD-2 plus VHHGSDMD-6 was performed using commercial kits from Molecular Dimensions (Maumee, OH, USA) and Jena Bioscience (Jena ...
-
No products found
because this supplier's products are not listed.
Andreas K Brödel, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... cell cultures were shifted to 37°C for 3 to 6 hours in an orbital shaker at 180 rpm (New Brunswick Innova 44). Samples were centrifuged for 10 min at 4,500g and cell pellets were resuspended and lysed with B-PER reagent (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 6-8 μM (Spherotech) were washed twice with wash buffer (20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Eric M. Mulhall, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica microspheres (200 μL of 1% w/v, 3 μM; Bangs Laboratories) were cleaned and hydroxylated by first washing them in a glass tube in MilliQ water ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Christopher J. Neufeldt, et al.,
bioRxiv - Microbiology 2020
Quote:
... cells were treated for 6 h with serial dilution of IFNα2 (PBL Assay Science, 11100-1), IFNβ (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Jennifer A. Rinker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were deeply anesthetized with vaporized isoflurane (1-3%, SomnoSuite Vaporizer, Kent Scientific) and 200 nl of AAV1-CaMKII-GCaMP6f (Addgene ...
-
No products found
because this supplier's products are not listed.
Keith A. Breau, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 1 mL cold neutralized collagen solution was added to 6-well tissue culture plates (Genesee 25-105) pre-warmed to 37 °C ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
No products found
because this supplier's products are not listed.
Kathrin Leppek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
No products found
because this supplier's products are not listed.
Roy A. Ehling, et al.,
bioRxiv - Immunology 2021
Quote:
Transfected cells were sorted for HDR+ by staining for Strep-Tactin-APC 1:100 (IBA lifesciences, Cat: 6-5010-001) and anti-hIgG AF488 1:100 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Roshan Nepal, et al.,
bioRxiv - Microbiology 2023
Quote:
... Resorufin fluorescence was monitored at the 1- hr interval for 6 hours using the CLARIOstar Plus (BMG Labtech, Ortenberg, Germany) microplate reader (excitation = 530 nm ...
-
No products found
because this supplier's products are not listed.
Gabriela Souza Barbosa, et al.,
bioRxiv - Physiology 2023
Quote:
Male and female C57Bl/6 mice (6-8 weeks of age) were divided into 4 groups and fed either a normal diet (ND; Research Diets, D12328 ...
-
No products found
because this supplier's products are not listed.
Bailey AT Weatherbee, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... cells were passaged to mitomycin-C inactivated CF-1 MEFs (3×103 cells/cm2; GSC-6101G, Amsbio) in media consisting of DMEM/F12 with 20% Knockout Serum Replacement (10828010 ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...