-
No products found
because this supplier's products are not listed.
Stephanie S. Kim, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
No products found
because this supplier's products are not listed.
Vipin Rawat, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... then adding 15 µL of methoxy amine in pyridine (MOX) (Thermo Fisher) and incubating at 40°C for 90 min ...
-
No products found
because this supplier's products are not listed.
Conny Leistner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... injection of 5 mg/kg Methoxy-X04 (Tocris) in 10% w/v DMSO containing phosphate-buffered saline ...
-
No products found
because this supplier's products are not listed.
Joseph O. Magliozzi, James B. Moseley,
bioRxiv - Cell Biology 2021
Quote:
... all strains were grown in YE4S at 32°C and treated with 30 μM 3-Brb-PP1 (3-[(3-Bromophenyl)methyl]-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine (Abcam) for 1 h and fixed in ice-cold 70% ethanol ...
-
No products found
because this supplier's products are not listed.
Chisato M. Yamazaki, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and 1-methoxy-5-methylphenazinium methylsulfate (1-methoxy PMS, 100 μM, Cayman Chemical) was added to each well ...
-
No products found
because this supplier's products are not listed.
Kemin Tan, et al.,
bioRxiv - Immunology 2023
Quote:
... 1,2-dioleoyl-sn-glycero-3-phospho-(1’-rac-glycerol) (DOPG) and 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (DSPE-PEG) (Avanti Polar Lipids Inc.) at a molar ratio of 2:2:1:1 ...
-
No products found
because this supplier's products are not listed.
Caleb Ruiz-Jiménez, et al.,
bioRxiv - Immunology 2021
Quote:
... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
No products found
because this supplier's products are not listed.
Cody M. Rogers, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
No products found
because this supplier's products are not listed.
Michael Lawless, et al.,
bioRxiv - Physiology 2019
Quote:
... Plasmid DNA (6 µg) was mixed (1 : 3 ratio) with transfection reagent (Fugene 6; Promega, UK) in reduced serum media (OptiMEM ...
-
No products found
because this supplier's products are not listed.
Juan Qin, et al.,
bioRxiv - Biochemistry 2021
Quote:
... PKAc was immobilized via standard N-hydroxysuccinimide (NHS) / 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) amine coupling on a CM5 (carboxyl methyl dextran) sensor chip (GE Healthcare). Before covalent immobilization of PKAc ...
-
No products found
because this supplier's products are not listed.
Hannah Elcocks, et al.,
bioRxiv - Cell Biology 2023
Quote:
... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
No products found
because this supplier's products are not listed.
Mahebali Tabusi, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 male C57BL/6 wild-type mice 5 to 6 weeks old (Charles River) per experimental group were used that were anesthetized by inhalation of isofluorane (Abbott ...
-
No products found
because this supplier's products are not listed.
Wouter van Bergen, et al.,
bioRxiv - Biochemistry 2023
Quote:
... CuAAC components were added in the following order: 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (Lumiprobe), 2.5 mM CuSO4 5·H2O (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Pattama Wiriyasermkul, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 50 μL of 1 mg/mL XTT (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) (Biotium) was mixed with 5 μL of 1.5 mg/mL phenazine methosulfate ...
-
No products found
because this supplier's products are not listed.
Katarzyna Wacnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 µl of 1 M NaOH and 6 µl of Cell-Tak (Corning, 5% (w/v) in acetic acid ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Chisato M. Yamazaki, et al.,
bioRxiv - Bioengineering 2020
Quote:
Female BALB/cJ mice (5−6 weeks old, n = 3 per group, The Jackson Laboratory, Stock No: 000651) received a single dose of the MMAE/F 4+2 dual-drug ADC (20 or 40 mg kg−1) ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Jessica P. Kuppan, et al.,
bioRxiv - Microbiology 2021
Quote:
... and a mixture of biotin-PEG-amine / methoxy-PEG-amine (Rapp Polymere) was prepared in anhydrous acetone at a ratio of 10 mol% biotinylated PEG ...
-
No products found
because this supplier's products are not listed.
Natasja L. de Vries, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µg/mL anti-ULBP2/5/6 (clone 165903, R&D Systems), and 6 µg/mL anti-ULBP3 (clone 166510 ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
Tomas Kouba, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For labeling pCp-Cy5 (Cytidine-5’-phosphate-3’-(6-aminohexyl)phosphate (Jena bioscience), was ligated to the 3’ end of the 16 nt RNA using T4 RNA ligase (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Zackary Sabetta, et al.,
bioRxiv - Neuroscience 2023
Quote:
A total of 64 young adult age-matched male and naturally cycling female Sprague-Dawley rats (~3 months old; males 367 ± 3 g and females 235 ± 1.5 g; n = 5-6/group; Envigo, Indianapolis, IN, USA) were used in these experiments and maintained in a 12:12 h light:dark cycle in a temperature and humidity-controlled room ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Kazuki Nagata, et al.,
bioRxiv - Immunology 2023
Quote:
BMMCs were generated from the BM cells of C57BL/6 mice (Japan SLC, Hamamatsu, Japan) by cultivation in the presence of 5 ng/mL of mouse IL-3 (BioLegend) as previously described 18 ...
-
No products found
because this supplier's products are not listed.
Jasmim Leal, et al.,
bioRxiv - Bioengineering 2019
Quote:
... were conjugated to methoxy-PEG-amine 1KDa (Alfa Aesar, MA) or custom synthesized peptides (LifeTein ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Mònica B. Mendoza, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Adam Hansson, et al.,
bioRxiv - Microbiology 2023
Quote:
... 250 µM Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, Tokyo Chemical Industry Co., Ltd.) and 500 µM Ascorbic acid (Merk ...
-
No products found
because this supplier's products are not listed.
Andrew Pountain, et al.,
bioRxiv - Systems Biology 2023
Quote:
... All oligos were synthesized with a 3’ amine modification (LGC Biosearch Technologies). The oligos against a given gene (oligo set ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Mathew Miller, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
No products found
because this supplier's products are not listed.
Fabrice C. Bernard, et al.,
bioRxiv - Bioengineering 2021
Quote:
40 kDa methoxy polyethylene glycol (PEG) amine (JenKem Technology) was purchased as a dry lyophilized powder for PEG tracer synthesis ...
-
No products found
because this supplier's products are not listed.
Joshua D. Kerkaert, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 300μL of XTT solution was added to each well (0.5mg/mL XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] (VWR) with 25μM menadione in PBS) ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Patricia Bilodeau, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5’-ATAAGCTCCCTGCCCGAGTC-3’ (Santa Cruz sc-430739).
-
No products found
because this supplier's products are not listed.
Hye Sung Kim, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The media was changed daily and the iPSC cultures were split into 1:6-1:10 every 5 days using ReLeSR (Stemcell Technologies).
-
No products found
because this supplier's products are not listed.
Aidan B Estelle, et al.,
bioRxiv - Biophysics 2023
Quote:
... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch). Sections were counterstained with a fluorescent Nissl stain (NeuroTrace 435/445 blue ...
-
No products found
because this supplier's products are not listed.
Ana Paula Zen Petisco Fiore, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3 and 6 hours with the inhibitors for ILK (1 μM CPD022, Calbiochem, #407331), FAK (5 μM FAK inhibitor 14 ...
-
No products found
because this supplier's products are not listed.
Alexis M. Crockett, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Antibodies were diluted in 3% normal donkey serum (monoclonal mouse anti-mouse GFAP 1:2000, Sigma G-A-5; polyclonal rabbit anti-human IL-6 1:50, Proteintech), and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Sergii Palchevskyi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 5-6 mM LMNG (Anatrace) and 1-1.2 mM Cholesteryl Hemisuccinate Tris Salt (CHS ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... an imidazoquinoline amine analog to guanosine (Invivogen). TLR9 or TLR7 activation was normalized to SEAP levels produced by infected null1 parental cells and is expressed as the fold-change over mock infected controls ...