-
No products found
because this supplier's products are not listed.
Paula Andrea Castañeda Londoño, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... 0.25% acryloylaminophenyl boronic acid (Sigma-Aldrich) and 100 mM Tris-acetate (pH 9.0) ...
-
No products found
because this supplier's products are not listed.
Duc Minh Nguyen, et al.,
bioRxiv - Pathology 2023
Quote:
... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Shigeo Takashima, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 14-eicosatrienoic acid (20:3 ω-6, sciadonic acid; Cayman Chemical, # 10009999), all cis-8 ...
-
No products found
because this supplier's products are not listed.
Gina K. Thomson, et al.,
bioRxiv - Microbiology 2019
Quote:
... Solution B comprised 30 μl of solution A supplemented with 2 μl of a solution prepared by dissolving 120 mg of phenyl boronic acid in 3 ml dimethyl sulfoxide (VWR International catalog # BDH1115-1LP) and adding this to 3 ml sterile inoculum water (Beckman Coulter ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Jessica Tang, et al.,
bioRxiv - Genomics 2020
Quote:
... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
No products found
because this supplier's products are not listed.
Jinmo Kim, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 4 or 8 μl of 6-OHDA (5 μg in 1 μl saline containing 0.1% ascorbic acid; Tocris, Bristol ...
-
No products found
because this supplier's products are not listed.
Clément M Potel, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Silica beads functionalized with phenyl-boronic acid (Bondesil-PBA 40µm, Agilent) were used for glycopeptides enrichment at an optimized ratio of 1:2.5 sample:PBA beads w/w ...
-
No products found
because this supplier's products are not listed.
Carlos J. Garcia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Authentic standards of 3,7-Dihydroxy-5-cholan-24-oic Acid (chenodeoxycholic acid) and 3-Hydroxy-11-oxo-5-cholan-24-oic Acid (3-oxo-chenodeoxycholic acid) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). The N-(3α,7α,12α-trihydroxy-5β-cholan-24-oyl)-glycine (glycocholic acid) ...
-
No products found
because this supplier's products are not listed.
Ser Sue Ng, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5% acetic acid (Merck), and dried using SpeedVac (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Cody M. Rogers, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
No products found
because this supplier's products are not listed.
Mahebali Tabusi, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 male C57BL/6 wild-type mice 5 to 6 weeks old (Charles River) per experimental group were used that were anesthetized by inhalation of isofluorane (Abbott ...
-
No products found
because this supplier's products are not listed.
Opeyemi Ernest Oludada, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 mM EDTA) and then detected with 2,2’-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) diammonium (ABTS) substrate (Roche Diagnostics) diluted at 1:1000 in H2O2 ...
-
No products found
because this supplier's products are not listed.
Shigeo Takashima, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 19-docosahexaenoic acid (22:6 ω-3, DHA, Tokyo Chemical Industry/TCI, Tokyo, Japan, #D2226). The FA standards were dissolved in a solution containing two volumes of chloroform and one volume of methanol with 0.05% (w/v ...
-
No products found
because this supplier's products are not listed.
Niels Frimodt-Møller, et al.,
bioRxiv - Microbiology 2023
Quote:
... 6 μL S30 premix without amino acids (Promega), plus water to a final reaction volume of 15 μL were incubated for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Ethan W. Morgan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Indole-3-propionic acid and indole-3-lactic acid were from Alfa Aesar (Heysham, UK). AIN93G was purchased from Dyets ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Huan Du, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
No products found
because this supplier's products are not listed.
Chisato M. Yamazaki, et al.,
bioRxiv - Bioengineering 2020
Quote:
Female BALB/cJ mice (5−6 weeks old, n = 3 per group, The Jackson Laboratory, Stock No: 000651) received a single dose of the MMAE/F 4+2 dual-drug ADC (20 or 40 mg kg−1) ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
Sonali Roy, et al.,
bioRxiv - Plant Biology 2022
Quote:
... X-GlcA ((5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid, Goldbio) in DMF (Dimethyl formamide) ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Stefano Comazzetto, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Mx1-Cre mice were given 3 intraperitoneal injections over 5 days of 40µg of polyinosinic-polycytidilic acid (poly I:C) (GE Healthcare) dissolved in PBS ...
-
No products found
because this supplier's products are not listed.
Tomas Kouba, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For labeling pCp-Cy5 (Cytidine-5’-phosphate-3’-(6-aminohexyl)phosphate (Jena bioscience), was ligated to the 3’ end of the 16 nt RNA using T4 RNA ligase (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Katarzyna Wacnik, et al.,
bioRxiv - Microbiology 2021
Quote:
... 3 µl of 1 M NaOH and 6 µl of Cell-Tak (Corning, 5% (w/v) in acetic acid ...
-
No products found
because this supplier's products are not listed.
Zackary Sabetta, et al.,
bioRxiv - Neuroscience 2023
Quote:
A total of 64 young adult age-matched male and naturally cycling female Sprague-Dawley rats (~3 months old; males 367 ± 3 g and females 235 ± 1.5 g; n = 5-6/group; Envigo, Indianapolis, IN, USA) were used in these experiments and maintained in a 12:12 h light:dark cycle in a temperature and humidity-controlled room ...
-
No products found
because this supplier's products are not listed.
Maxime Deforet,
bioRxiv - Systems Biology 2023
Quote:
... 5 g/L casamino acids (Bacto, BD)) was solidified with agar (Bacto ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
Natasja L. de Vries, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µg/mL anti-ULBP2/5/6 (clone 165903, R&D Systems), and 6 µg/mL anti-ULBP3 (clone 166510 ...
-
No products found
because this supplier's products are not listed.
Michele LeRoux, et al.,
bioRxiv - Microbiology 2021
Quote:
... 5-6[3H] (Perkin Elmer) (6 µCi/mL) ...
-
No products found
because this supplier's products are not listed.
Eri Hirata, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 5-Fluoroorotic acid (5-FOA; ZYMO RESEARCH F9003), or doxycycline (Sigma D9891) ...
-
No products found
because this supplier's products are not listed.
Sandip M. Swain, Rodger A. Liddle,
bioRxiv - Cell Biology 2020
Quote:
... 6-eicosatrienoic acid (Santa Cruz Biotechnology; sc-221066), arachidonic acid (Sigma ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Aidan B Estelle, et al.,
bioRxiv - Biophysics 2023
Quote:
... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... fixed in Methacarn (1/3/6 mixture of acetic acid/chloroform/methanol) overnight at room temperature and stained with carmine alum (Stem Cell Technologies), or fixed in 4% paraformaldehyde overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Caitriona M. McEvoy, et al.,
bioRxiv - Immunology 2021
Quote:
Commercially available human primary PTs from 6 donors (3 males and 3 females, Lonza Walkersville Inc) were expanded at passage 4 ...
-
No products found
because this supplier's products are not listed.
Kazuki Nagata, et al.,
bioRxiv - Immunology 2023
Quote:
BMMCs were generated from the BM cells of C57BL/6 mice (Japan SLC, Hamamatsu, Japan) by cultivation in the presence of 5 ng/mL of mouse IL-3 (BioLegend) as previously described 18 ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Anna L. Vlasits, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Boroscillate pipettes (Sutter Instruments, 3-5 MΩ) were used for all recordings and whole-cell electrophysiology recordings were performed using a Multiclamp 700B amplifier (Molecular devices) ...
-
No products found
because this supplier's products are not listed.
Agata Szuba, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 5 mM dithiothreitol (DTT)) at 4°C overnight and concentrated to ~3-5 mg/mL using Vivaspin 6 concentrators (Sartorius, 6 ml, 100 kDa cut-off). Mammalian septin hexamers composed of mouse Sept2 (98.6% identical to human Sept2 ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Cheryl E. G. Leyns, et al.,
bioRxiv - Neuroscience 2022
Quote:
... antigen retrieval was performed by using either formic acid for 5 minutes at room temperature or citric acid pH=6 (Vector Laboratories; Cat# H-3300) for 15 minutes at 95 °C ...
-
Cat# HY-W002339-500 mg,
500 mg, USD $50.0
Ask
Pooja Khanna, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 3-bromopyruvic acid (MedChemExpress, HY-19992) was diluted in DMSO and cells were treated at the indicated concentrations ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Slides were rinsed in tap water and dipped 3-5 times in 0.5% Acid Alcohol (Leica Biosystems 3803651), followed by rinsing in tap water and bluing with Scott’s Tap Water (Electron Microscopy Sciences 2607007 ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Katrin Gerstmann, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Electrodes (3-6 MΩ, borosilicate glass Harvard Apparatus) were filled with a solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Paula I Seoane, et al.,
bioRxiv - Microbiology 2019
Quote:
... polyinosinic-polycytidilic acid (polyIC) at 3 and 30 ng/mL (Invivogen), type-I interferon receptor inhibitor (IFNARinh ...
-
No products found
because this supplier's products are not listed.
Thivanka Muthumalage, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and 6 hours using microplate spectrophotometer (Cytation 5, Biotek).