-
No products found
because this supplier's products are not listed.
Ravi Lokwani, et al.,
bioRxiv - Bioengineering 2022
Quote:
... The wound was then subsequently closed with 3-4 wound clips (7 mm, Roboz) and the procedure was repeated on the contralateral leg ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Balakumaran Chandrasekar, et al.,
bioRxiv - Microbiology 2021
Quote:
... The freeze-dried material was dialyzed against 3 liters of Milli-Q water at 4°C using a 1 kDa cut-off dialysis tubing (Repligen Spectra/Por 6 Pre-Wetted Regenerated Cellulose ...
-
No products found
because this supplier's products are not listed.
Huiyuan Zheng, et al.,
bioRxiv - Neuroscience 2022
Quote:
Adult male and female Gcg-Cre rats from the FSU colony (N=4) were anesthetized by isoflurane inhalation (1–3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
Cat# 587840-28-6,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Augusto Cesar Hunt-Serracin, et al.,
bioRxiv - Microbiology 2019
Quote:
... 4 g of Deoxyribonucleic Acid (Spectrum Chemicals), 5.9 mg diethylene triamine pentaacetic acid (DTPA) ...
-
No products found
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
C Spourquet, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and Dox 4 days (Day 4) thyroid (n=4; 2 males and 2 females for each group) were sequenced by GENEWIZ-NGS Europe (Germany ...
-
No products found
because this supplier's products are not listed.
Luisa de Lemos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... at a ratio of 1:4-1:6 in mTeSRTM Plus medium supplemented with 10 μM of ROCK inhibitor Y-27632 (Focus Biomolecules) and maintained at 37 °C in a humidified atmosphere containing 5% CO2.
-
No products found
because this supplier's products are not listed.
Sheng Wu, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... (±)4-deoxyorobanchol (also named as (±)-2’-epi-5-deoxystrigol) were acquired from Chempep Inc ...
-
No products found
because this supplier's products are not listed.
Gongshi Bai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The primary antibodies were diluted in 3% BSA/PBS and incubated overnight at 4°C: rabbit anti-G4 (clone 1H6, Absolute Antibody ab00389-23.0, 1:500), goat anti-G4 (clone 1H6 ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Lili Qin, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... DCs were collected and cocultured with autologous CD8+ T cells with the ratio between 1:4 to 1:10 in AIM-V medium with 5% autologous serum and 30 ng/ml IL-21 (Cellgenix, Germany). Two days later ...
-
No products found
because this supplier's products are not listed.
Wim J. de Jonge, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... by bead beating 7 times 3 minutes in a Genie Disruptor (Scientific Industries). The lysate was recovered and centrifuged at 1503g for 2 minutes at 4°C to remove cell debris ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Yilin Yang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cdh5-CreERT2 mice (3 Kate2 vs. 4 HDAC6) were fed with a control liquid diet (F1259SP, Bio-Serv) for 10 days and were sacrificed for sample collection ...
-
Cat# LC10000,
10mg, USD $170.00/10mg
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Kayla Gentile, et al.,
bioRxiv - Biophysics 2021
Quote:
... Ethylenediamine tetraacetic acid disodium salt (EDTA; IBI Scientific) was added in the last 5 minutes to experiments so that its final concentration was 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Erika K. Ramos, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cells were seeded into 6-well or 12-well plates at a concentration of 2,000 or 1,000 cells per well in replicates of 3 or 4 using Prime-XV Tumorsphere Serum Free Media (Irvine Scientific). Cells were monitored for up to 17 days ...
-
No products found
because this supplier's products are not listed.
Frank Hidalgo, et al.,
bioRxiv - Biophysics 2022
Quote:
... Peptides were desalted for 4 minutes on a trap column (1 mM ID x 2 cm, IDEX C-128) manually packed with POROS R2 reversed-phase resin (Thermo Scientific 1112906) ...
-
No products found
because this supplier's products are not listed.
Mariève D. Boulanger, et al.,
bioRxiv - Bioengineering 2021
Quote:
... were reacted for 2 h with 150 μL/cm2 of a 3 mg/mL suspension of sulfo-succinimidyl-4-(p-maleimidophenyl)-butyrate (S-SMPB, #BC24, G-Biosciences) in phosphate buffered saline solution (PBS ...
-
No products found
because this supplier's products are not listed.
Frederike Winkel, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3) rabbit anti-phospho Kv3.1 (1:100) (#75-041, Phosphosolutions, Aurora, CO) overnight at +4° C ...
-
No products found
because this supplier's products are not listed.
Jia Tian, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... chicken anti-type 3 adenylyl cyclase (1:5000; Encor Biotechnology; Cat# CPCA-ACIII), and rabbit anti-PCM1 (1:1000 ...
-
No products found
because this supplier's products are not listed.
Yubing Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Sections were incubated overnight with primary antibodies in incubation buffer at 4°C (Hopx, 1:1000, HPA030180, Atlas Antibodies; Lpar1, 1:1000, NBP1-03363, Novus Biologicals; Sox2, 1:2000, GT15098, Neuromics; YFP, 1:1000). Sections were rinsed 3 times in wash buffer for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Artur Mittring, Tobias Moser, Antoine Huet,
bioRxiv - Neuroscience 2022
Quote:
... and 100 Uml−1 of salt-activated nuclease (Arcticzymes, USA) at 37 °C for 30 min ...
-
No products found
because this supplier's products are not listed.
Phuong T. Lam, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Corning)-coated dishes in NIM at an approximate density of 20 aggregates per cm2 and switched to DMEM/F12 (3:1) supplemented with 2% Gem21 NeuroPlex (without vitamin A, Gemini Bio-Products, 400-161), 1X NEAA ...
-
No products found
because this supplier's products are not listed.
Patricia C. Lopes, Robert de Bruijn,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... Tissue homogenization was done by agitating the tubes for 20□s at a 7□m□s−□1 speed (Beadbug 6 homogenizer, Benchmark Scientific), followed by a 5□min rest period ...
-
No products found
because this supplier's products are not listed.
Ching-Lin Hsieh, et al.,
bioRxiv - Microbiology 2020
Quote:
... with a 4:1 ratio of O2/H2 and stained using methylamine tungstate (Nanoprobes). Grids were imaged at a magnification of 92,000X (corresponding to a calibrated pixel size of 1.63 Å/pix ...
-
No products found
because this supplier's products are not listed.
Yinan Hu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... then incubated at 4°C overnight with a rabbit T4 antibody (1:1000, Fitzgerald). Slides were then washed ...
-
No products found
because this supplier's products are not listed.
Alexandre Dumoulin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were diluted in blocking buffer and added to spinal cords for incubation overnight a 4°C (1:800 of goat-anti-GFP-FITC, Rockland; 1:5,000 of rabbit-anti-RFP, antibodies-online). The next day ...
-
No products found
because this supplier's products are not listed.
Themistoklis Zisis, et al.,
bioRxiv - Biophysics 2021
Quote:
... we added a 7 μl drop of 1mg/ml PLL(20)-g[3.5]-PEG-N3(3) (APP) (Susos AG, Switzerland) solution in MilliQ right next to each stamp allowing surface tension to absorb the liquid underneath the stamp ...
-
No products found
because this supplier's products are not listed.
Allison R. Fusilier, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Blots were blocked in blocking buffer for 1 hour at room temperature and probed overnight at 4°C for PER2 (1:1000 in 5% BSA and TBST; Alpha Diagnostic Intl., Inc., #PER21-A), BMAL1 (1:1000 in 5% BSA and TBST ...
-
No products found
because this supplier's products are not listed.
Adriana C. Rodriguez, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and incubated overnight at 4°C in primary antibodies: ETV4 (Aviva ARP 32263_P050; 1:500 dilution), ERα (Santa Cruz HC-20 ...
-
No products found
because this supplier's products are not listed.
Salman Sohrabi, Vanessa Cota, Coleen T. Murphy,
bioRxiv - Bioengineering 2023
Quote:
Molds for layer #3 and layer #5 (Figure S1d) are fabricated using SU-8 2075 (MicroChem, Newton, MA, USA) spin-coated at 2150rpm for 30s to create ∼100μm tall patterns (Figure S2a ...
-
No products found
because this supplier's products are not listed.
Sutanuka Chakraborty, et al.,
bioRxiv - Microbiology 2020
Quote:
All the flow cytometry data analyses were performed using FCS Express 4 and 6 versions (De Novo Software, Los Angeles, CA).
-
No products found
because this supplier's products are not listed.
Jesse V Veenvliet, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Gastruloids were washed twice with PBS and then fixed in 4% PFA for 1 h in glass vials (Wheaton 224882) at 4°C on a roller ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... aqueous uranyl acetate (5 min) and Reynolds lead citrate (3 min) before routine imaging on a JEM-1400PLUS TEM (JEOL). For quantification ...
-
No products found
because this supplier's products are not listed.
Ariane Zutz, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The isolated fractions were separated on SDS-PAGE (RunBlue 4-20 %, Expedeon; NuPAGE®Bis-Tris gel 4-12%, Invitrogen) and analysed by InstantBlue staining (Expedeon ...
-
No products found
because this supplier's products are not listed.
Caitlin L. Maikawa, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 4-((((2-carboxyethyl)thio)carbonothioyl)thio)-4-cyanopentanoic acid (BM1433; Boron Molecular, >95%) were used as received ...
-
No products found
because this supplier's products are not listed.
Erin M. Euliano, et al.,
bioRxiv - Bioengineering 2024
Quote:
... 2 equivalents of 4-((6-Amino-2-(2-methoxyethoxy)-8-oxo-7,8-dihydro-9H-purin-9-yl)methyl)benzoic acid (Ambeed, Arlington Heights, IL), also known as 1V209 ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... while injections of CTb 1% (low salt, 1%, List Biological Laboratories, Campbell, CA) in distilled water ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Francesca Murganti, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Cells were fixed with 4% formaldehyde solution in PBS for 10 min and stained overnight at 4 °C with primary antibodies against mVenus (1:800, Biorbyt, orb334993) and mCherry (1:250 ...