-
No products found
because this supplier's products are not listed.
Dominique Vanhecke, Viola Bugada, Thorsten Buch,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... Both MOE and SOE emulsions were freshly made on the day of treatment by emulsification during 10 minutes at room temperature using 2 mL Luer-Lock syringes (Braun # 4606701V) connected with a one-way Luer female to female adaptor (Cadence Science #6521IND).
-
No products found
because this supplier's products are not listed.
David Jukam, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Eggs were irradiated by placing the 6 cm petri dish in a dark chamber for 2 minutes under a 500 Watt Hg arc lamp (Oriel Instruments) producing a downward facing focused beam with diameter of ∼8 cm such that every egg in the dish was covered by the UV light ...
-
No products found
because this supplier's products are not listed.
Man Ying Wong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... IL-6 (Bon Opus Biosciences#BE010059B), and TNFα (Biolegend#430901 ...
-
No products found
because this supplier's products are not listed.
Vivian Tam, et al.,
bioRxiv - Systems Biology 2020
Quote:
... (McGill University) and one aged (59M) from Articular Engineering, LLC (IL ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Sergio M. Pontejo, Philip M. Murphy,
bioRxiv - Immunology 2020
Quote:
... Plates were developed with TMB One Component (Surmodics, Eden Prairie, MN) and the reaction was stopped with sulfuric acid before measuring the absorbance at 450 nm (A450 ...
-
No products found
because this supplier's products are not listed.
Yedan Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... One fiber-optic probe (91-00124, Perimed Inc., Las Vegas, NV) coupled with a laser-Doppler flowmeter (LDF ...
-
No products found
because this supplier's products are not listed.
Andrew R Gross, Roberta S. Santos, Dhruv Sareen,
bioRxiv - Bioengineering 2021
Quote:
... supplemented with 6 uM CHIR99021 (Xcess Biosciences m60002). After 48 hours the cells were fed with stage 2 differentiation medium consisting of STEMDiff APEL supplemented with 50 ng/mL of VEGF 165 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Nadejda Bozadjieva Kramer, et al.,
bioRxiv - Physiology 2020
Quote:
Insulin levels (6-hour fasting) were measured with ELISAs (Crystal Chem) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sarah A. Nordeen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Derivative crystals were obtained by applying 0.2ul of 0.1M [TeW6O24]6- (MiTeGen) to drops containing Nup84-Nup133CTD-VHH-SAN8 crystals ...
-
No products found
because this supplier's products are not listed.
Ward Vleeshouwers, et al.,
bioRxiv - Immunology 2020
Quote:
... Cells were plated one day prior to measurements or transfection in Willco dishes (Willco Wells BV) at 400.000 cells/dish or in 96 well-plate (microplate BD Falcon ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Cheng Zhang, et al.,
bioRxiv - Systems Biology 2022
Quote:
... and the Pklr KO mice as well as the wild-type ones are purchased from Applied StemCell company ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Satish K. Tadi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Samples were then loaded into custom-made C18 StageTips packed by stacking one AttractSPE® disk (#SPE-Disks-Bio-C18-100.47.20 Affinisep) and 2mg beads (#186004521 SepPak C18 Cartridge Waters ...
-
No products found
because this supplier's products are not listed.
Flávia Viana, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10-4 and 10-6 were automatically plated using easySpiral® automatic plater (Interscience, France) in triplicates on BCYE agar ...
-
No products found
because this supplier's products are not listed.
Nisha Dhanushkodi, et al.,
bioRxiv - Immunology 2022
Quote:
... HSV-2 DNA copy number was determined using purified HSV-2 DNA (Advanced Biotechnologies, Columbia, MD) and based on a standard curve of the CT values ...
-
No products found
because this supplier's products are not listed.
Christopher J. Emig, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... SARS-CoV-2 Delta Variant pseudovirus (eEnzyme) was diluted 1:2 in DMEM complete media to a pseudoviral particle concentration of 5e7/ml ...
-
No products found
because this supplier's products are not listed.
Yun Liu, Weichun Lin,
bioRxiv - Neuroscience 2022
Quote:
... μ-conotoxin GIIIB (2 μM; Peptides International) was added to the bath solution 30 minutes prior to recording ...
-
No products found
because this supplier's products are not listed.
Raul Jobava, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... harringtonine (2 μg/mL) (LKT Laboratories, H0169), sephin 1 (Apexbio,A8708 ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... BYL719 at 2 or 10 μM (Chemietek) and 2 nM BMP6 (R&D ...
-
No products found
because this supplier's products are not listed.
Sudhir Kumar, et al.,
bioRxiv - Microbiology 2021
Quote:
... Gametocyte cultures were set up in 6 well plates using O+ human RBCs (Valley Biomedical, VA, US) and O+ human serum (Interstate Blood Bank ...
-
No products found
because this supplier's products are not listed.
Shaohe Wang, Kazue Matsumoto, Kenneth M. Yamada,
bioRxiv - Developmental Biology 2020
Quote:
Spheroids were rinsed in 2 mL PBS in a 35 mm dish and transferred into sample baskets (one basket per staining group; Intavis, 12.440) using low-retention pipette tips (cut for larger opening; Rainin, 30389187 or 30389190) under a dissecting microscope ...
-
No products found
because this supplier's products are not listed.
P. Baumert, et al.,
bioRxiv - Physiology 2020
Quote:
... were placed along the sagittal axis over the muscle belly at 33% of the respective muscle length from the distal end [according to SENIAM guidelines 58] and one reference electrode (Ambu Blue, Ambu, Copenhagen, Denmark) was positioned over the medial tibial condyle ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... was from Oakwood Chemical (Estill, SC), perfluorohexanesulfonic acid (PFHxS, CAS 3871-99-6, purity ≥ 98%) was from J&K Scientific (Beijing, China), and PFOS (CAS 2795-39-3 ...
-
TRAP-6 (2-6) is a peptide.
Cat# abx265781-5MG,
5 mg USD $246.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Dalia Raïch-Regué, et al.,
bioRxiv - Microbiology 2022
Quote:
... The amount of SARS-CoV-2 nucleoprotein released to the supernatant was measured with SARS-CoV-2 nucleocapsid protein High-Sensitivity Quantitative ELISA (ImmunoDiagnostics) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Anna Kirjavainen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 2% Choleratoxin B subunit (#104; List Biological Lab.Inc.) were injected at the speed of 50 nl/min using a microinjector (UltraMicroPump III ...
-
No products found
because this supplier's products are not listed.
Fei Mao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... anti-GAPDH antibody (catalog # 2-RGM2, Advanced ImmunoChemical) was used at 1 μg/mL.
-
No products found
because this supplier's products are not listed.
Cheryl Immethun, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The cultures were loaded into a Greiner CELLSTAR® bio-one sterile 48 well culture plate and covered with a Breathe-Easy® Gas Permeable Sealing Membrane (Diversified Biotech). Cultures were then incubated in the dark at 30°C in ambient air for 72 hours at 275 rpm ...
-
No products found
because this supplier's products are not listed.
Paola Benaglio, et al.,
bioRxiv - Genomics 2020
Quote:
Peripheral blood mononuclear cells (PBMCs) from 10 individuals (4 females and 6 males) were purchased from HemaCare (Northridge, CA) and profiled for snATAC using 10x Genomics Chromium Single Cell ATAC Solution ...
-
No products found
because this supplier's products are not listed.
Ryutaro Ariyoshi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and MTG mutant was purified with size exclusion chromatography using ProteoSEC-D 16/60 6-600 HR (Protein Ark) with PBS (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Wentao Yu, et al.,
bioRxiv - Bioengineering 2021
Quote:
... An optical long-pass filter can be placed before the tube lens to further reduce the backscattered UV light. A custom-built 2-axis angle adjustable platform (Supplementary Fig. 2) under the vibratome (VF-700-0Z, Precisionary Instruments Inc.) ensures the focal plane of the objective lens is parallel with the surface of the sample sectioned by the vibratome ...
-
No products found
because this supplier's products are not listed.
Nicholas B. Karabin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 1 µg of each protein sample was separated in one dimension using 4-20% tris-glycine gels (Mini-PROTEAN TGX, Bio-Rad Laboratories, Inc.). A 1:6 dilution of the PageRuler Plus pre-stained protein ladder (10 µl ...
-
No products found
because this supplier's products are not listed.
Yildirim Dogan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... or IGF2 (5e-2 pM – 5e2 nM; Cell Sciences). Subsequently ...
-
No products found
because this supplier's products are not listed.
Ulri N. Lee, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and 2 g of Yeast Extract (United States Biological Corporation ...
-
Cat# F107,
USD $169.00/EA
Ask
Ekaterina V. Tarasovetc, et al.,
bioRxiv - Cell Biology 2020
Quote:
... blocked with 2 mM biotinylated dPEG (2.5 kDa, Quanta BioDesign), washed extensively by centrifuging three times at 2,000 g ...
-
No products found
because this supplier's products are not listed.
Sara M. Eslami, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Quartz spectrophotometer cell (Starna Cells, cat. no. 1-Q-2) and measured using an Olis Cary-16 circular dichroism spectrometer ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Aurelie Velay, et al.,
bioRxiv - Microbiology 2020
Quote:
... ELISA anti-SARS-CoV-2 IgA and IgG (Euroimmun, Lübeck, Germany) and (2) ELISA-2: EDI™ novel coronavirus COVID-19 IgM and IgG (Epitope Diagnostics, San Diego, CA, USA). Technical characteristics of the assays are summarized in the Supplementary data (Table S1) ...
-
No products found
because this supplier's products are not listed.
Alena Rudkouskaya, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The excitation was set to 750 nm, and the emission filter were 820±6 nm (Semrock, FF01-820/12-25) and 810±45 (Chroma Technology, ET810/90). The imaging parameters were set the same for all mice.
-
No products found
because this supplier's products are not listed.
Ali Khateb, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The plates were briefly centrifuged at 1000 rpm and incubated at 37°C with 5% CO2 for an additional 6 days using MicroClime Environmental lids (Labcyte, San Jose, CA). Plates were placed at room temperature for 30 min to equilibrate ...
-
No products found
because this supplier's products are not listed.
Raegan Paul, et al.,
bioRxiv - Biochemistry 2023
Quote:
... temperature and pH were measured directly in the fluids using a portable YSI Plus 6-Series Sonde Multimeter (YSI Incorporated, Yellow springs, OH) and 0.5 to 1.5 liters of hydrothermal fluids venting from the subsurface were collected ...
-
No products found
because this supplier's products are not listed.
Jonna Heldrich, et al.,
bioRxiv - Genomics 2020
Quote:
... Samples were immunoprecipitated with 2 μL of either anti-Top2 (TopoGEN, #TG2014), anti-MYC 9E11 (Abcam ...
-
No products found
because this supplier's products are not listed.
Nick Quinn-Bohmann, et al.,
bioRxiv - Systems Biology 2023
Quote:
Fecal samples were collected in 1200 mL 2-piece specimen collectors (Medline, USA) in the Public Health Science Division of the Fred Hutchinson Cancer Center (IRB Protocol number 10961 ...
-
No products found
because this supplier's products are not listed.
Hyunjoon Kim, Soohyun Jang, Young-suk Lee,
bioRxiv - Molecular Biology 2021
Quote:
... cells were selected with medium containing 1∼2 μg/ml puromycin (AG Scientific #P-1033) until non-transduced cells became completely dead ...
-
No products found
because this supplier's products are not listed.
Pavlo Gilchuk, et al.,
bioRxiv - Immunology 2020
Quote:
... mice were treated with 2 mg of an Ifnar1-blocking antibody (MAR1-5A3, Leinco Technologies) by i.p ...
-
No products found
because this supplier's products are not listed.
Emily Speranza, et al.,
bioRxiv - Immunology 2021
Quote:
... slides were de-waxed according to a standard protocol of 2 washes of Xylene (Newcomer Supply) for 10 minutes each ...
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...
-
No products found
because this supplier's products are not listed.
Meghan D. J. Bragdon, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
Yeast colonies were picked from plates and cultured overnight in 2 mL liquid synthetic defined (SD) media with appropriate auxotrophic dropouts (Sunrise Science Products). Cultures were diluted 1:50 into 500 µL of synthetic complete (SC ...