-
No products found
because this supplier's products are not listed.
Naphat Chantaravisoot, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... GSN knockdown experiments were performed using 2’-deoxy-2’-fluoro-D-arabinonucleic acid antisense oligonucleotides (FANA Antisense Oligos; FANA ASOs) against GSN or scrambled control FANA purchased from AUM BioTech.
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Valentin Gfeller, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Each plot was 6 m long and 3 m wide and separated from each other by 3 m of buffer of alfalfa (Medicago sativa). Maize was grown from Mai to September 2018 followed by wheat from October to July 2019 ...
-
No products found
because this supplier's products are not listed.
Neal I. Callaghan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... N-sulfosuccinimidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH, CovaChem, Loves Park, IL) was solubilized in DMSO (0.25% final concentration ...
-
No products found
because this supplier's products are not listed.
Marisol Romero-Tejeda, et al.,
bioRxiv - Cell Biology 2023
Quote:
... consisting of RPMI 1640 supplemented with 2 mg/mL fatty acid-free bovine serum albumin (GenDEPOT, A0100), 200 µg/mL L-ascorbic acid 2-phosphate (Wako, 321-44823) and 2 µM Wnt-C59 (Biorbyt, orb181132). Medium was then changed on day 4 and then every other day with RBAI consisting of RPMI 1640 supplemented with 500 µg/mL fatty acid-free bovine serum albumin ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... then spotted on nitrocellulose membrane alongside serotype 4 capsular polysaccharide 3-6 μg (SSI Diagnostica cat. 76855). The membrane was then blocked with 5% BSA in TBS with 0.05% Tween-20 and probed overnight with anti-pneumococcus capsular antibody (1:500 ...
-
No products found
because this supplier's products are not listed.
Ons M’Saad, Joerg Bewersdorf,
bioRxiv - Cell Biology 2020
Quote:
... or 200 μM NHS ester-DY634 (Dyomics, catalog no. 634-01A), dissolved in 100 mM sodium bicarbonate (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and PFOS (CAS 2795-39-3, purity ≥ 98%) and Perfluoro-3,6,9-trioxadecanoic acid (PFO3DoDA, CAS 151772-59-7, purity 98%) were from Matrix Scientific (Columbia, SC). Nafion byproduct 2 (CAS 749836-20-2 ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... version 6 (DNAStar). Consensus sequences were derived from at least two independent forward and reverse sequences ...
-
No products found
because this supplier's products are not listed.
Yuyan Cheng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cholera toxin B subunit (CTB, 3 µl/eye, 2 µg/µl, List Biological Laboratories, Inc., 103B) was injected intraocularly as an anterograde tracer to label axons regenerating through the optic nerve.
-
No products found
because this supplier's products are not listed.
Tongjie Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... adult C57BL/6 (CD45.1, 8-10 weeks old) recipient mice were irradiated with 2 doses of 4.5Gy (RS 2000, Rad Source) for a 4-hour interval ...
-
Glucose-6-Phosphate Dehydrogenase Kit
Cat# DGPDH-100,
1.0 kit, 100 tests, USD $339.0
Ask
Kaori Kobayashi, et al.,
bioRxiv - Immunology 2021
Quote:
The concentrations of total sialic acid (TSA) and free sialic acid (FSA) in saliva were measured using a sialic acid assay kit (Bioassay Systems). The concentration of protein-bound sialic acid (BSA ...
-
No products found
because this supplier's products are not listed.
Yulia Kiyan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and co-transfected (using ratio pWPTS-HPSE2:pCMV-dR8.74:pMD2G = 3:2:1) into 293T cells using PerFectin transfection reagent (Genlantis) as per manufacturer ...
-
No products found
because this supplier's products are not listed.
Leena Putzeys, et al.,
bioRxiv - Microbiology 2022
Quote:
... 0.5% casein amino acids (LabM, Neogen), 2 mM MgSO4 ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... with 1 or 5 μg rSp alone or mixed with either 1 mg Advax-SM adjuvant or where indicated 50 μg Al(OH)3 (2% Alhydrogel, Croda Denmark) in the thigh muscle at weeks 0 and 2 ...
-
No products found
because this supplier's products are not listed.
Zengqi Zhao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... fatty acid free BSA (Equitech-Bio, USA) was dissolved in FBS-free DMEM at room temperature according the ratio 1:100 (1 g fatty-acid free BSA ...
-
No products found
because this supplier's products are not listed.
Nobuyuki Oguri, et al.,
bioRxiv - Pathology 2023
Quote:
... except that the reactions were started with 300 μM N-benzoyl-L-isoleucyl-L-glutamyl-glycyl-Larginine-p-nitroaniline hydrochloride and its methyl ester (Chromogenix S-2222, Diapharma) and 300 μM Chromogenix S-2366 (Diapharma).
-
No products found
because this supplier's products are not listed.
Campbell D. Lawson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 10 nM leptomycin b, vehicle control or library compounds (Supplementary Tables 2, 3) were added using an Echo liquid handler (Labcyte/Beckman Coulter). Cells were incubated for a further 24 h then fixed in 4% paraformaldehyde and stained with DAPI and Alexa Fluor 488 Phalloidin (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Megan E. Patton, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Calorimetric measurement of serum and hepatic bile acids was performed with the Total Bile Acid (NBT method) kit (Genway Biotech).
-
WB, ELISA
Cat# CDC-53,
0.05 mg, Inquire
Ask
Benoit Forget, et al.,
bioRxiv - Neuroscience 2021
Quote:
... pmirGLO-3’UTR_FosB and pmirGLO-3’UTR_Npas4 plasmids were purchased from Creative Biogene and the mimick-miR-1a-3p and mimick-miR-negative control from Qiagen (miScript miRNA Mimics) ...
-
No products found
because this supplier's products are not listed.
Maxwell P. Bui-Marinos, et al.,
bioRxiv - Zoology 2020
Quote:
... gel containing 1× RedSafe Nucleic Acid Staining Solution (FroggaBio) and electrophoresed in 1× Tris-Acetate-EDTA (TAE ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Jingyou Yu, et al.,
bioRxiv - Microbiology 2021
Quote:
... The plates were washed with ELISPOT wash buffer (11% 10x DPBS and 0.3% Tween20 in 1L MilliQ water) and incubated for 2 h with Rabbit polyclonal anti-human IFN-γ Biotin from U-Cytech (1 µg/mL). The plates were washed a second time and incubated for 2 h with Streptavidin-alkaline phosphatase from Southern Biotech (2 µg/mL) ...
-
No products found
because this supplier's products are not listed.
Eric P. Schultz, et al.,
bioRxiv - Microbiology 2020
Quote:
... and 6% Fetalgro® (Rocky Mountain Biologicals, Missoula, MT, USA). Retinal pigment epithelial cells (ARPE19)(American Type Culture Collection ...
-
No products found
because this supplier's products are not listed.
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... Hoechst 33342 Fluorescent Nucleic Acid Stain (#639, ImmunoChemistry Technologies, 1:200), goat anti-rabbit IgG(H+L ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Mark Terasaki, Jason Cory Brunson, Justin Sardi,
bioRxiv - Cell Biology 2020
Quote:
... with a 6 mm wide histo diamond knife (Diatome, Hatfield, PA) was used cut 500 nm thick sections ...
-
No products found
because this supplier's products are not listed.
Jana-Freja Frommann, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 0.1% (v:v) formic acid (∼98%, LC-MS grade, Honeywell Research Chemicals, Fluka) in H2OMilliQ (phase A ...
-
No products found
because this supplier's products are not listed.
Seiya Yamada, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Periodic Acid-Schiff (PAS) Diastase Stain Kit (for polysaccharides staining) (ScyTek Laboratories), and Amyloid Stain Kit (Congo Red ...
-
No products found
because this supplier's products are not listed.
Adam McNee, et al.,
bioRxiv - Immunology 2020
Quote:
... were coated with 2 μg/ml rec 2-12C (Absolute Antibody) in PBS-T overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Craig T. Connors, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 6 weeks-of-age were analyzed by ELISA for insulin (Alpco) and glucagon content (Mercodia) ...
-
No products found
because this supplier's products are not listed.
Petra Pjevac, et al.,
bioRxiv - Microbiology 2019
Quote:
... Sample aliquots were transferred to 6 ml exetainer screw cap vials (Labco Limited) directly from the Niskin bottles ...
-
No products found
because this supplier's products are not listed.
Sarah A Fahlberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3 μg/mL anti-myc IgY (Aves Labs) conjugated with Alexa488 using NHS chemistry ...
-
No products found
because this supplier's products are not listed.
Kristoffer Krogerus, Nils Rettberg, Brian Gibson,
bioRxiv - Microbiology 2022
Quote:
... after which spores from the different parental strains were dissected and placed next to each other on YPD agar plates (1 % yeast extract, 2 % peptone, 2 % glucose, and 2 % agar) using a micromanipulator (Singer Instruments, UK). The plates were incubated at 25 °C for 3 days ...
-
No products found
because this supplier's products are not listed.
Sujeong Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the samples were further treated further with 50 mU of chondro-6-sulfatase (Seikagaku). Samples were centrifuged ...
-
No products found
because this supplier's products are not listed.
Teresa L. Street, et al.,
bioRxiv - Microbiology 2019
Quote:
... Urine samples were collected into universal tubes containing boric acid (Medline Scientific, Chalgrove, Oxfordshire, UK), and latterly also into cobas PCR Media tubes (Roche Molecular Systems ...
-
No products found
because this supplier's products are not listed.
Huan Huan Tan, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Seeded cells (5 x 104 cells/mL) in 6-well plate (Nest Biotechnology, Jiangsu, China) were pretreated with BK3C231 at 6.25 μM ...
-
No products found
because this supplier's products are not listed.
Etai Sapoznik, et al.,
bioRxiv - Biophysics 2020
Quote:
... #1.5 coverslips (0420-0323-2, Bioptechs) were washed at room temperature in solution consisting of 1:1 (vol/vol ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Alyssa Ann La Bella, et al.,
bioRxiv - Microbiology 2022
Quote:
... When urine was supplemented with Fg (Enzyme Research Laboratories FIB 3), it was added directly to the sterilized urine and the urine was not sterilized after the addition of Fg.
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Katherine Williams, et al.,
bioRxiv - Genomics 2021
Quote:
... and 2% Ultrasor G (Crescent Chemical Co.). Day 0 cells were kept at low confluency to prevent spontaneous differentiation ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... pICln guide 2 was acquired from Cellecta in vector pRSG17 ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2% fetal bovine serum (FBS) (Wisent Bioproducts), and 1% penicillin/streptomycin (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Alexander von Appen, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat α-Tubulin (YL1/2; Accurate Chemical & Scientific), SUN1 (ab124770 ...
-
No products found
because this supplier's products are not listed.
Rudolf O. Schlechter, et al.,
bioRxiv - Microbiology 2023
Quote:
... gas permeability of 0.6 m3 m−2 day−1 and water loss of 1 g m−2 day−1; Brooks Life Sciences, UK), and incubated at 30°C with shaking ...
-
No products found
because this supplier's products are not listed.
Alexandra Tsirigotaki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The hLeptin:hLEP-RCRH2 complex (6 mg/mL) was subjected to crystallization trials using a Mosquito liquid handling robot (TTP Labtech) in sitting drop format ...
-
No products found
because this supplier's products are not listed.
Alena Rudkouskaya, et al.,
bioRxiv - Bioengineering 2019
Quote:
... The excitation was set to 750 nm, and the emission filter were 820±6 nm (Semrock, FF01-820/12-25) and 810±45 (Chroma Technology, ET810/90). The imaging parameters were set the same for all mice.
-
No products found
because this supplier's products are not listed.
Cato Prince, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 2 mM MgCl2 and 200 U of mSAN nuclease (Arcticzymes catalog #70950-150). Cell lysates were incubated at 37°C for 1 hour ...